add crabs/insilicopcr module from readsimulator

[famosab]

PR checklist

Closes #5533

• This comment contains a description of changes (with reason).
• If you've fixed a bug or added code that should be tested, add tests!
• If you've added a new tool - have you followed the module conventions in the contribution docs
• If necessary, include test data in your PR.
• Remove all TODO statements.
• Emit the versions.yml file.
• Follow the naming conventions.
• Follow the parameters requirements.
• Follow the input/output options guidelines.
• Add a resource label
• Use BioConda and BioContainers if possible to fulfil software requirements.
• Ensure that the test works with either Docker / Singularity. Conda CI tests can be quite flaky:
  • For modules:
    • nf-core modules test <MODULE> --profile docker
    • nf-core modules test <MODULE> --profile singularity
    • nf-core modules test <MODULE> --profile conda
  • For subworkflows:
    • nf-core subworkflows test <SUBWORKFLOW> --profile docker
    • nf-core subworkflows test <SUBWORKFLOW> --profile singularity
    • nf-core subworkflows test <SUBWORKFLOW> --profile conda

[famosab]

CRABS has changed a lot of its functionality when updating to version 1.0.0. This needs to be taken care of!

[famosab]

When we change to the genome-ena.fasta:

│   Command executed:                                                                                                                                                                                                                                                                           │
│                                                                                                                                                                                                                                                                                               │
│     crabs --in-silico-pcr \                                                                                                                                                                                                                                                                   │
│         --input genome-ena.fasta \                                                                                                                                                                                                                                                            │
│         --output test.crabs.fa \                                                                                                                                                                                                                                                              │
│         --threads 2 \                                                                                                                                                                                                                                                                         │
│         --forward "GTCGGTAAAACTCGTGCCAGC" --reverse "CATAGTGGGGTATCTAATCCCAGTTTG"                                                                                                                                                                                                             │
│                                                                                                                                                                                                                                                                                               │
│     cat <<-END_VERSIONS > versions.yml                                                                                                                                                                                                                                                        │
│     "CRABS_INSILICOPCR":                                                                                                                                                                                                                                                                      │
│         crabs: $(crabs --help | grep 'CRABS |' | sed 's/.*CRABS | \(v[0-9.]*\).*/\1/')                                                                                                                                                                                                        │
│     END_VERSIONS                                                                                                                                                                                                                                                                              │
│                                                                                                                                                                                                                                                                                               │
│   Command exit status:                                                                                                                                                                                                                                                                        │
│     1                                                                                                                                                                                                                                                                                         │
│                                                                                                                                                                                                                                                                                               │
│   Command output:                                                                                                                                                                                                                                                                             │
│     |         Import data |                                       0% -:--:-- 0:00:00                                                                                                                                                                                                          │
│                                                                                                                                                                                                                                                                                               │
│   Command error:                                                                                                                                                                                                                                                                              │
│     /usr/local/lib/python3.12/site-packages/function/crabs_functions.py:775: SyntaxWarning: invalid escape sequence '\.'                                                                                                                                                                      │
│       for item in ['_sp\.','_SP\.','_indet.', '_sp.', '_SP.']:                                                                                                                                                                                                                                │
│     /usr/local/lib/python3.12/site-packages/function/crabs_functions.py:775: SyntaxWarning: invalid escape sequence '\.'                                                                                                                                                                      │
│       for item in ['_sp\.','_SP\.','_indet.', '_sp.', '_SP.']:                                                                                                                                                                                                                                │
│     Matplotlib created a temporary cache directory at /tmp/matplotlib-dtwy8p2_ because the default path (/.config/matplotlib) is not a writable directory; it is highly recommended to set the MPLCONFIGDIR environment variable to a writable directory, in particular to speed up the       │
│ import of Matplotlib and to better support multiprocessing.                                                                                                                                                                                                                                   │
│                                                                                                                                                                                                                                                                                               │
│     /// CRABS | v1.0.7                                                                                                                                                                                                                                                                        │
│                                                                                                                                                                                                                                                                                               │
│     |            Function | Extract amplicons through in silico PCR                                                                                                                                                                                                                           │
│     |         Import data |                                       0% -:--:-- 0:00:00                                                                                                                                                                                                          │
│     Traceback (most recent call last):                                                                                                                                                                                                                                                        │
│       File "/usr/local/bin/crabs", line 847, in <module>                                                                                                                                                                                                                                      │
│         crabs()                                                                                                                                                                                                                                                                               │
│       File "/usr/local/lib/python3.12/site-packages/click/core.py", line 1157, in __call__                                                                                                                                                                                                    │
│         return self.main(*args, **kwargs)                                                                                                                                                                                                                                                     │
│                ^^^^^^^^^^^^^^^^^^^^^^^^^^                                                                                                                                                                                                                                                     │
│       File "/usr/local/lib/python3.12/site-packages/rich_click/rich_command.py", line 152, in main                                                                                                                                                                                            │
│         rv = self.invoke(ctx)                                                                                                                                                                                                                                                                 │
│              ^^^^^^^^^^^^^^^^                                                                                                                                                                                                                                                                 │
│       File "/usr/local/lib/python3.12/site-packages/click/core.py", line 1434, in invoke                                                                                                                                                                                                      │
│         return ctx.invoke(self.callback, **ctx.params)                                                                                                                                                                                                                                        │
│                ^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^                                                                                                                                                                                                                                        │
│       File "/usr/local/lib/python3.12/site-packages/click/core.py", line 783, in invoke                                                                                                                                                                                                       │
│         return __callback(*args, **kwargs)                                                                                                                                                                                                                                                    │
│                ^^^^^^^^^^^^^^^^^^^^^^^^^^^                                                                                                                                                                                                                                                    │
│       File "/usr/local/bin/crabs", line 612, in crabs                                                                                                                                                                                                                                         │
│         temp_input_path, fasta_dict = crabs_to_fasta(console, columns, input_)                                                                                                                                                                                                                │
│                                       ^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^                                                                                                                                                                                                                │
│       File "/usr/local/lib/python3.12/site-packages/function/crabs_functions.py", line 1066, in crabs_to_fasta                                                                                                                                                                                │
│         fasta_string = f'>{lineparts[0]}\n{lineparts[1]}\n'                                                                                                                                                                                                                                   │
│                                            ~~~~~~~~~^^^                                                                                                                                                                                                                                       │
│     IndexError: list index out of range 

[famosab]

This step probably needs to be implemented as a module first:
https://github.com/gjeunen/reference_database_creator?tab=readme-ov-file#52-module-2-import-downloaded-data-into-crabs-format