keep fasta header lines unmodified, if ranges are provided

[tolot27]

Currently, the range coordinates are appended to the sequence ID, if specified (i. e. contig1:20-200). I want to keep the FASTA header lines unmodified. I tried to fix it by myself but there are some mixtures of long_name and full_name in the source code.

[tolot27]

What me confuses is that the command line parameter --full-names is passed as argument long_names. I suggest renaming full-names/long_names to full-header, at least in the source code. That would make it easier to add new parameters addressing this issue.

[mdshw5]

Yeah, the .long_name property for a Sequence object just constructs the seq:start-end (complement) string, while the FastaRecord.long_name property retrieves the entire defline (header) from the fasta file. These are really two distinct actions, and it's unfortunate I've named them identically.

I previously deprecated Sequence.longname in favor of Sequence.long_name, so I'll move Sequence.long_name -> Sequence.fancy_name since that's what I initially wanted to call it anyway.

[mdshw5]

Is this the behavior you were expecting?

With coordinates:

$ faidx --auto-strand tests/data/genes.fasta 'gi|563317589|dbj|AB821309.1|:100-1'
>gi|563317589|dbj|AB821309.1|:100-1 (complement)
CTAATGTGGTATCCTCAACTAAACTGAAGGAGGGCCGGGCCAGGGACAAGGTTGCCATGGTGACCACGAC
CAGGCAGATGAAACGACCCCAGCTGACCAT

Without coordinates:

$ faidx --no-coords --auto-strand tests/data/genes.fasta 'gi|563317589|dbj|AB821309.1|:100-1'
>gi|563317589|dbj|AB821309.1|
CTAATGTGGTATCCTCAACTAAACTGAAGGAGGGCCGGGCCAGGGACAAGGTTGCCATGGTGACCACGAC
CAGGCAGATGAAACGACCCCAGCTGACCAT

[tolot27]

I'm unsure ich that's wächst Ihr expect. I just want an option which does not modify the ID or better, not changing the ID should be the default behavior as it was with some previous versions.
It looks like your second example with the --no-coords parameter removes already present coordinates.
That raises the question what happens if a sequence identifier has a "coordinate suffix" and I extract a sequence range. Will than an additional coordinate set appended?

[tolot27]

Okay, your commit does not remove already existing coordinates.
Regarding to my second concern of appending additional coordinates: this supports my suggestion that no-coords should be the default. Otherwise it would become a bit confusing if someone extracts nested ranges.

[mdshw5]

I think I’m going to leave the defaults as is. To me it’s quite a bit more confusing to extract a subsequence and have it labeled exactly the same as the original subject sequence. You’re never going to please everyone! Thanks for your contribution!

[tolot27]

Thanks for the really fast implementation and also for merging my PR.