Merge pull request #191 from ap--/pytest-xfail

Minor change in pytest xfail usage in tests
mdshw5 · May 31, 2022 · 6b7d4c5 · 6b7d4c5
2 parents badbfd4 + 1566fe2
commit 6b7d4c5
Show file tree

Hide file tree

Showing 9 changed files with 55 additions and 64 deletions.
diff --git a/tests/test_Fasta_bgzip.py b/tests/test_Fasta_bgzip.py
@@ -70,9 +70,9 @@ def test_line_len(remove_index):
     for record in fasta:
         assert len(next(iter(record))) == fasta.faidx.index[record.name].lenc
 
-@pytest.mark.xfail(raises=UnsupportedCompressionFormat)
 def test_mutable_bgzf(remove_index):
-    fasta = Fasta('data/genes.fasta.gz', mutable=True)
+    with pytest.raises(UnsupportedCompressionFormat):
+        fasta = Fasta('data/genes.fasta.gz', mutable=True)
 
 @pytest.mark.xfail(raises=NotImplementedError)
 def test_long_names(remove_index):
@@ -120,15 +120,14 @@ def test_fetch_end(remove_index):
                          480, 481)
     assert str(result) == expect
 
-@pytest.mark.xfail(raises=FetchError)
 def test_fetch_border(remove_index):
     """ Fetch past the end of a gene entry """
     faidx = Faidx('data/genes.fasta.gz')
     expect = 'TC'
-    result = faidx.fetch('gi|557361099|gb|KF435150.1|',
-                         480, 500)
-    print(result)
-    assert str(result) == expect
+    with pytest.raises(FetchError):
+        result = faidx.fetch('gi|557361099|gb|KF435150.1|', 480, 500)
+        print(result)
+        assert str(result) == expect
 
 def test_rev(remove_index):
     faidx = Faidx('data/genes.fasta.gz')
@@ -137,33 +136,29 @@ def test_rev(remove_index):
                          480, 481)
     assert str(-result) == expect, result
 
-@pytest.mark.xfail(raises=FetchError)
 def test_fetch_past_bounds(remove_index):
     """ Fetch past the end of a gene entry """
     faidx = Faidx('data/genes.fasta.gz', strict_bounds=True)
-    result = faidx.fetch('gi|557361099|gb|KF435150.1|',
-                                     480, 5000)
+    with pytest.raises(FetchError):
+        result = faidx.fetch('gi|557361099|gb|KF435150.1|', 480, 5000)
 
-@pytest.mark.xfail(raises=FetchError)
 def test_fetch_negative(remove_index):
     """ Fetch starting with a negative coordinate """
     faidx = Faidx('data/genes.fasta.gz', strict_bounds=True)
-    result = faidx.fetch('gi|557361099|gb|KF435150.1|',
-                                     -10, 10)
+    with pytest.raises(FetchError):
+        result = faidx.fetch('gi|557361099|gb|KF435150.1|', -10, 10)
 
-@pytest.mark.xfail(raises=FetchError)
 def test_fetch_reversed_coordinates(remove_index):
     """ Fetch starting with a negative coordinate """
     faidx = Faidx('data/genes.fasta.gz', strict_bounds=True)
-    result = faidx.fetch('gi|557361099|gb|KF435150.1|',
-                                     50, 10)
+    with pytest.raises(FetchError):
+        result = faidx.fetch('gi|557361099|gb|KF435150.1|', 50, 10)
 
-@pytest.mark.xfail(raises=FetchError)
 def test_fetch_keyerror(remove_index):
     """ Fetch a key that does not exist """
     faidx = Faidx('data/genes.fasta.gz', strict_bounds=True)
-    result = faidx.fetch('gi|joe|gb|KF435150.1|',
-                                     1, 10)
+    with pytest.raises(FetchError):
+        result = faidx.fetch('gi|joe|gb|KF435150.1|', 1, 10)
 
 def test_blank_string(remove_index):
     """ seq[0:0] should return a blank string mdshw5/pyfaidx#53 """
@@ -230,12 +225,12 @@ def test_issue_79_fix_one_based_false_negate(remove_index):
     print(s.__dict__)
     assert (105, 100) == (s.start, s.end)
 
-@pytest.mark.xfail(raises=FetchError)
 def test_fetch_border_padded(remove_index):
     """ Fetch past the end of a gene entry """
-    faidx = Faidx('data/genes.fasta.gz', default_seq='N')
-    expect = 'TCNNNNNNNNNNNNNNNNNNN'
-    result = faidx.fetch('gi|557361099|gb|KF435150.1|',
-                         480, 500)
-    print(result)
-    assert str(result) == expect
+    with pytest.raises(FetchError):
+        faidx = Faidx('data/genes.fasta.gz', default_seq='N')
+        expect = 'TCNNNNNNNNNNNNNNNNNNN'
+        result = faidx.fetch('gi|557361099|gb|KF435150.1|',
+                             480, 500)
+        print(result)
+        assert str(result) == expect
diff --git a/tests/test_faidx.py b/tests/test_faidx.py
@@ -16,9 +16,9 @@ def remove_index():
     except EnvironmentError:
         pass  # some tests may delete this file
 
-@pytest.mark.xfail(raises=BedError)
 def test_short_line_lengths(remove_index):
-    main(['data/genes.fasta', '--bed', 'data/malformed.bed'])
+    with pytest.raises(BedError):
+        main(['data/genes.fasta', '--bed', 'data/malformed.bed'])
 
 def test_fetch_whole_file(remove_index):
     main(['data/genes.fasta'])
@@ -28,9 +28,9 @@ def test_split_entry(remove_index):
     assert os.path.exists('gi557361099gbKF435150.1.fasta')
     os.remove('gi557361099gbKF435150.1.fasta')
 
-@pytest.mark.xfail(raises=FetchError)
 def test_fetch_error(remove_index):
-    main(['data/genes.fasta', 'gi|557361099|gb|KF435150.1|:1-1000'])
+    with pytest.raises(FetchError):
+        main(['data/genes.fasta', 'gi|557361099|gb|KF435150.1|:1-1000'])
 
 def test_key_warning(remove_index):
     main(['data/genes.fasta', 'foo'])

diff --git a/tests/test_feature_bounds_check.py b/tests/test_feature_bounds_check.py
@@ -93,33 +93,29 @@ def test_rev(remove_index):
                          480, 481)
     assert str(-result) == expect, result
 
-@pytest.mark.xfail(raises=FetchError)
 def test_fetch_past_bounds(remove_index):
     """ Fetch past the end of a gene entry """
     faidx = Faidx('data/genes.fasta', strict_bounds=True)
-    result = faidx.fetch('gi|557361099|gb|KF435150.1|',
-                                     480, 5000)
+    with pytest.raises(FetchError):
+        result = faidx.fetch('gi|557361099|gb|KF435150.1|', 480, 5000)
 
-@pytest.mark.xfail(raises=FetchError)
 def test_fetch_negative(remove_index):
     """ Fetch starting with a negative coordinate """
     faidx = Faidx('data/genes.fasta', strict_bounds=True)
-    result = faidx.fetch('gi|557361099|gb|KF435150.1|',
-                                     -10, 10)
+    with pytest.raises(FetchError):
+        result = faidx.fetch('gi|557361099|gb|KF435150.1|', -10, 10)
 
-@pytest.mark.xfail(raises=FetchError)
 def test_fetch_reversed_coordinates(remove_index):
     """ Fetch starting with a negative coordinate """
     faidx = Faidx('data/genes.fasta', strict_bounds=True)
-    result = faidx.fetch('gi|557361099|gb|KF435150.1|',
-                                     50, 10)
+    with pytest.raises(FetchError):
+        result = faidx.fetch('gi|557361099|gb|KF435150.1|', 50, 10)
 
-@pytest.mark.xfail(raises=FetchError)
 def test_fetch_keyerror(remove_index):
     """ Fetch a key that does not exist """
     faidx = Faidx('data/genes.fasta', strict_bounds=True)
-    result = faidx.fetch('gi|joe|gb|KF435150.1|',
-                                     1, 10)
+    with pytest.raises(FetchError):
+        result = faidx.fetch('gi|joe|gb|KF435150.1|', 1, 10)
 
 def test_blank_string(remove_index):
     """ seq[0:0] should return a blank string mdshw5/pyfaidx#53 """

diff --git a/tests/test_feature_indexing.py b/tests/test_feature_indexing.py
@@ -331,13 +331,12 @@ def test_read_back_index(remove_index):
     finally:
         locale.setlocale(locale.LC_NUMERIC, old_locale)
 
-@pytest.mark.xfail(raises=IndexNotFoundError)
 def test_issue_134_no_build_index(remove_index):
     """ Ensure that index file is not built when build_index=False. See mdshw5/pyfaidx#134.
     """
-    faidx = Faidx('data/genes.fasta', build_index=False)
+    with pytest.raises(IndexNotFoundError):
+        faidx = Faidx('data/genes.fasta', build_index=False)
 
-@pytest.mark.xfail(raises=FastaIndexingError)
 def test_issue_144_no_defline(remove_index):
     """ Ensure that an exception is raised when a file contains no deflines. See mdshw5/pyfaidx#144.
     """
@@ -347,6 +346,7 @@ def test_issue_144_no_defline(remove_index):
         # Write simple fasta file
         with open(fasta_path, 'w') as fasta_out:
             fasta_out.write("CTCCGGGCCCAT\nATAAAGCCTAAA\n")
-        faidx = Faidx(fasta_path)
+        with pytest.raises(FastaIndexingError):
+            faidx = Faidx(fasta_path)
     finally:
         shutil.rmtree(tmp_dir)
diff --git a/tests/test_feature_key_function.py b/tests/test_feature_key_function.py
@@ -60,9 +60,9 @@ def test_key_function_by_fetch(remove_index):
                          100, 150)
     assert str(result) == expect
 
-@pytest.mark.xfail(raises=ValueError)
 def test_duplicated_keys(remove_index):
-    genes = Fasta('data/genes.fasta', key_function=get_duplicated_gene_name)
+    with pytest.raises(ValueError):
+        genes = Fasta('data/genes.fasta', key_function=get_duplicated_gene_name)
 
 def test_duplicated_keys_shortest(remove_index):
     genes = Fasta('data/genes.fasta', key_function=get_duplicated_gene_name, duplicate_action="shortest")

diff --git a/tests/test_feature_read_ahead_buffer.py b/tests/test_feature_read_ahead_buffer.py
@@ -31,11 +31,11 @@ def test_buffer_exceed(remove_index):
     result = fasta['gi|557361099|gb|KF435150.1|'][0:400].seq.lower()
     assert result == expect
 
-@pytest.mark.xfail(raises=FetchError)
 def test_bounds_error(remove_index):
     fasta = Fasta('data/genes.fasta', read_ahead=300, strict_bounds=True)
-    result = fasta['gi|557361099|gb|KF435150.1|'][100-1:15000].seq.lower()
+    with pytest.raises(FetchError):
+        result = fasta['gi|557361099|gb|KF435150.1|'][100-1:15000].seq.lower()
 
-@pytest.mark.xfail(raises=ValueError)
 def test_buffer_value(remove_index):
-    Fasta('data/genes.fasta', read_ahead=0.5)
+    with pytest.raises(ValueError):
+        Fasta('data/genes.fasta', read_ahead=0.5)
diff --git a/tests/test_feature_sequence_as_raw.py b/tests/test_feature_sequence_as_raw.py
@@ -25,15 +25,15 @@ def test_as_raw_true(remove_index):
     result = fasta['gi|557361099|gb|KF435150.1|'][100-1:150].lower()
     assert result == expect
 
-@pytest.mark.xfail(raises=AttributeError)
 def test_as_raw_false_error(remove_index):
     fasta = Fasta('data/genes.fasta')
-    result = fasta['gi|557361099|gb|KF435150.1|'][100-1:150].lower()
+    with pytest.raises(AttributeError):
+        result = fasta['gi|557361099|gb|KF435150.1|'][100-1:150].lower()
 
-@pytest.mark.xfail(raises=AttributeError)
 def test_as_raw_true_error(remove_index):
     fasta = Fasta('data/genes.fasta', as_raw=True)
-    result = fasta['gi|557361099|gb|KF435150.1|'][100-1:150].seq.lower()
+    with pytest.raises(AttributeError):
+        result = fasta['gi|557361099|gb|KF435150.1|'][100-1:150].seq.lower()
 
 def test_as_raw_type_when_blen_lt_0(remove_index):
     fasta = Fasta('data/genes.fasta', as_raw=True)

diff --git a/tests/test_feature_split_char.py b/tests/test_feature_split_char.py
@@ -33,6 +33,6 @@ def test_key_function_by_fetch(remove_index):
                          100, 150)
     assert str(result) == expect
 
-@pytest.mark.xfail(raises=ValueError)
 def test_stop(remove_index):
-    fasta = Fasta('data/genes.fasta', split_char='|')
+    with pytest.raises(ValueError):
+        fasta = Fasta('data/genes.fasta', split_char='|')
diff --git a/tests/test_sequence_class.py b/tests/test_sequence_class.py
@@ -19,25 +19,25 @@ def test_negate_metadata():
     seq_neg = -seq
     assert seq_neg.__repr__() == seq.complement[::-1].__repr__()
 
-@pytest.mark.xfail(raises=ValueError)
 def test_seq_invalid():
-    seq_invalid.complement()
+    with pytest.raises(ValueError):
+        seq_invalid.complement()
 
 def test_integer_index():
     assert seq[1].seq == 'T'
 
 def test_slice_index():
     assert seq[0:10].seq == 'TTGAAGATTT'
 
-@pytest.mark.xfail(raises=ValueError)
 def test_comp_invalid():
-    complement(comp_invalid)
+    with pytest.raises(ValueError):
+        complement(comp_invalid)
 
-@pytest.mark.xfail(raises=ValueError)
 def test_check_coordinates():
     x = Sequence(name='gi|557361099|gb|KF435150.1|', seq='TTGAAGATTTTGCATGCAGCAGGTGCGCAAGGTGAAATGTTCACTGTTAAA',
                  start=100, end=110)
-    x[:]
+    with pytest.raises(ValueError):
+        _ = x[:]
 
 def test_comp_valid():
     assert complement(comp_valid).startswith("AACTTCTAAAnCG")