Add nucleotide-count exercise (#286)

config.json

@@ -333,6 +333,15 @@
           "math"
         ]
       },
+      {
+        "slug": "nucleotide-count",
+        "name": "Nucleotide Count",
+        "uuid": "4ce578b2-9cfb-498b-947f-79f97abeb224",
+        "practices": [],
+        "prerequisites": [],
+        "difficulty": 2,
+        "topics": []
+      },
       {
         "slug": "eliuds-eggs",
         "name": "Eliud's Eggs",

exercises/practice/nucleotide-count/.docs/instructions.md

@@ -0,0 +1,23 @@
+# Instructions
+
+Each of us inherits from our biological parents a set of chemical instructions known as DNA that influence how our bodies are constructed.
+All known life depends on DNA!
+
+> Note: You do not need to understand anything about nucleotides or DNA to complete this exercise.
+
+DNA is a long chain of other chemicals and the most important are the four nucleotides, adenine, cytosine, guanine and thymine.
+A single DNA chain can contain billions of these four nucleotides and the order in which they occur is important!
+We call the order of these nucleotides in a bit of DNA a "DNA sequence".
+
+We represent a DNA sequence as an ordered collection of these four nucleotides and a common way to do that is with a string of characters such as "ATTACG" for a DNA sequence of 6 nucleotides.
+'A' for adenine, 'C' for cytosine, 'G' for guanine, and 'T' for thymine.
+
+Given a string representing a DNA sequence, count how many of each nucleotide is present.
+If the string contains characters that aren't A, C, G, or T then it is invalid and you should signal an error.
+
+For example:
+
+```text
+"GATTACA" -> 'A': 3, 'C': 1, 'G': 1, 'T': 2
+"INVALID" -> error
+```

exercises/practice/nucleotide-count/.meta/config.json

@@ -0,0 +1,19 @@
+{
+  "authors": [
+    "keiravillekode"
+  ],
+  "files": {
+    "solution": [
+      "nucleotide-count.sml"
+    ],
+    "test": [
+      "test.sml"
+    ],
+    "example": [
+      ".meta/example.sml"
+    ]
+  },
+  "blurb": "Given a DNA string, compute how many times each nucleotide occurs in the string.",
+  "source": "The Calculating DNA Nucleotides_problem at Rosalind",
+  "source_url": "https://rosalind.info/problems/dna/"
+}

exercises/practice/nucleotide-count/.meta/example.sml

@@ -0,0 +1,13 @@
+fun nucleotideCounts (strand: string): {a: int, c: int, g: int, t: int} =
+  let
+    fun recurse(a: int, c: int, g: int, t: int, nil) = {a = a, c = c, g = g, t = t}
+      | recurse(a: int, c: int, g: int, t: int, hd :: tl) =
+          case hd of
+              #"A" => recurse(a + 1, c, g, t, tl)
+            | #"C" => recurse(a, c + 1, g, t, tl)
+            | #"G" => recurse(a, c, g + 1, t, tl)
+            | #"T" => recurse(a, c, g, t + 1, tl)
+            | _ => raise Fail "Invalid nucleotide in strand"
+  in
+    recurse (0, 0, 0, 0, explode strand)
+  end

exercises/practice/nucleotide-count/.meta/tests.toml

@@ -0,0 +1,25 @@
+# This is an auto-generated file.
+#
+# Regenerating this file via `configlet sync` will:
+# - Recreate every `description` key/value pair
+# - Recreate every `reimplements` key/value pair, where they exist in problem-specifications
+# - Remove any `include = true` key/value pair (an omitted `include` key implies inclusion)
+# - Preserve any other key/value pair
+#
+# As user-added comments (using the # character) will be removed when this file
+# is regenerated, comments can be added via a `comment` key.
+
+[3e5c30a8-87e2-4845-a815-a49671ade970]
+description = "empty strand"
+
+[a0ea42a6-06d9-4ac6-828c-7ccaccf98fec]
+description = "can count one nucleotide in single-character input"
+
+[eca0d565-ed8c-43e7-9033-6cefbf5115b5]
+description = "strand with repeated nucleotide"
+
+[40a45eac-c83f-4740-901a-20b22d15a39f]
+description = "strand with multiple nucleotides"
+
+[b4c47851-ee9e-4b0a-be70-a86e343bd851]
+description = "strand with invalid nucleotides"

exercises/practice/nucleotide-count/nucleotide-count.sml

@@ -0,0 +1,2 @@
+fun nucleotideCounts (strand: string): {a: int, c: int, g: int, t: int} =
+  raise Fail "'nucleotideCounts' is not implemented"

exercises/practice/nucleotide-count/test.sml

@@ -0,0 +1,27 @@
+(* version 1.0.0 *)
+
+use "testlib.sml";
+use "nucleotide-count.sml";
+
+infixr |>
+fun x |> f = f x
+
+val testsuite =
+  describe "nucleotide-count" [
+    test "empty strand"
+      (fn _ => nucleotideCounts "" |> Expect.equalTo {a = 0, c = 0, g = 0, t = 0}),
+
+    test "can count one nucleotide in single-character input"
+      (fn _ => nucleotideCounts "G" |> Expect.equalTo {a = 0, c = 0, g = 1, t = 0}),
+
+    test "strand with repeated nucleotide"
+      (fn _ => nucleotideCounts "GGGGGGG" |> Expect.equalTo {a = 0, c = 0, g = 7, t = 0}),
+
+    test "strand with multiple nucleotides"
+      (fn _ => nucleotideCounts "AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC" |> Expect.equalTo {a = 20, c = 12, g = 17, t = 21}),
+
+    test "strand with invalid nucleotides"
+      (fn _ => (fn _ => nucleotideCounts "AGXXACT") |> Expect.error (Fail "Invalid nucleotide in strand"))
+  ]
+
+val _ = Test.run testsuite

exercises/practice/nucleotide-count/testlib.sml

@@ -0,0 +1,160 @@
+structure Expect =
+struct
+  datatype expectation = Pass | Fail of string * string
+
+  local
+    fun failEq b a =
+      Fail ("Expected: " ^ b, "Got: " ^ a)
+
+    fun failExn b a =
+      Fail ("Expected: " ^ b, "Raised: " ^ a)
+
+    fun exnName (e: exn): string = General.exnName e
+  in
+    fun truthy a =
+      if a
+      then Pass
+      else failEq "true" "false"
+
+    fun falsy a =
+      if a
+      then failEq "false" "true"
+      else Pass
+
+    fun equalTo b a = 
+      if a = b
+      then Pass
+      else failEq (PolyML.makestring b) (PolyML.makestring a)
+
+    fun nearTo delta b a =
+      if Real.abs (a - b) <= delta * Real.abs a orelse
+         Real.abs (a - b) <= delta * Real.abs b
+      then Pass
+      else failEq (Real.toString b ^ " +/- " ^ Real.toString delta) (Real.toString a)
+
+    fun anyError f =
+      (
+        f ();
+        failExn "an exception" "Nothing"
+      ) handle _ => Pass
+
+    fun error e f =
+      (
+        f ();
+        failExn (exnName e) "Nothing"
+      ) handle e' => if exnMessage e' = exnMessage e
+                     then Pass
+                     else failExn (exnMessage e) (exnMessage e')
+  end
+end
+
+structure TermColor =
+struct
+  datatype color = Red | Green | Yellow | Normal
+
+  fun f Red    = "\027[31m"
+    | f Green  = "\027[32m"
+    | f Yellow = "\027[33m"
+    | f Normal = "\027[0m"
+
+  fun colorize color s = (f color) ^ s ^ (f Normal)
+
+  val redit = colorize Red
+
+  val greenit = colorize Green
+
+  val yellowit = colorize Yellow
+end
+
+structure Test =
+struct
+  datatype testnode = TestGroup of string * testnode list
+                    | Test of string * (unit -> Expect.expectation)
+
+  local
+    datatype evaluation = Success of string
+                        | Failure of string * string * string
+                        | Error of string * string
+
+    fun indent n s = (implode (List.tabulate (n, fn _ => #" "))) ^ s
+
+    fun fmt indentlvl ev =
+      let
+        val check = TermColor.greenit "\226\156\148 " (* ✔ *)
+        val cross = TermColor.redit "\226\156\150 "   (* ✖ *)
+        val indentlvl = indentlvl * 2
+      in
+      case ev of
+        Success descr => indent indentlvl (check ^ descr)
+      | Failure (descr, exp, got) =>
+          String.concatWith "\n" [indent indentlvl (cross ^ descr),
+                                  indent (indentlvl + 2) exp,
+                                  indent (indentlvl + 2) got]
+      | Error (descr, reason) =>
+          String.concatWith "\n" [indent indentlvl (cross ^ descr),
+                                  indent (indentlvl + 2) (TermColor.redit reason)]
+      end
+
+    fun eval (TestGroup _) = raise Fail "Only a 'Test' can be evaluated"
+      | eval (Test (descr, thunk)) =
+          (
+            case thunk () of
+              Expect.Pass   => ((1, 0, 0), Success descr)
+            | Expect.Fail (s, s') => ((0, 1, 0), Failure (descr, s, s'))
+          )
+          handle e => ((0, 0, 1), Error (descr, "Unexpected error: " ^ exnMessage e))
+
+    fun flatten depth testnode =
+      let
+        fun sum (x, y, z) (a, b, c) = (x + a, y + b, z + c)
+
+        fun aux (t, (counter, acc)) =
+          let
+            val (counter', texts) = flatten (depth + 1) t
+          in
+            (sum counter' counter, texts :: acc)
+          end
+      in
+        case testnode of
+          TestGroup (descr, ts) =>
+            let
+              val (counter, texts) = foldr aux ((0, 0, 0), []) ts
+            in
+              (counter, (indent (depth * 2) descr) :: List.concat texts)
+            end
+        | Test _ =>
+            let
+              val (counter, evaluation) = eval testnode
+            in
+              (counter, [fmt depth evaluation])
+            end
+      end
+
+    fun println s = print (s ^ "\n")
+  in
+    fun run suite =
+      let
+        val ((succeeded, failed, errored), texts) = flatten 0 suite
+
+        val summary = String.concatWith ", " [
+          TermColor.greenit ((Int.toString succeeded) ^ " passed"),
+          TermColor.redit ((Int.toString failed) ^ " failed"),
+          TermColor.redit ((Int.toString errored) ^ " errored"),
+          (Int.toString (succeeded + failed + errored)) ^ " total"
+        ]
+
+        val status = if failed = 0 andalso errored = 0
+                     then OS.Process.success
+                     else OS.Process.failure
+
+      in
+        List.app println texts;
+        println "";
+        println ("Tests: " ^ summary);
+        OS.Process.exit status
+      end
+  end
+end
+
+fun describe description tests = Test.TestGroup (description, tests)
+fun test description thunk = Test.Test (description, thunk)