ClonRecall: ClonMapper Recall Utility

Why?

Manually editing DNA sequences is error prone and tedious. This script is designed to quickly generate the necessary oligos and plasmid vectors for any specified ClonMapper barcode.

Setup

Only requirement is python3.

Start by cloning the repo.

git clone [email protected]:brocklab/clonrecall.git
cd clonrecall

Usage

There are two commands for clonrecall each has essentially the same sets of flags to control behavior.

For each command you need to specify a 20bp barcode sequence and a name. You may also provide a headerless csv with multiple barcodes.

example csv:

lin1,GCAATATGCGGTACGATTCG
lin2,ACGGGTAGACCATACGATGC

Oligos

To generate all six oligos which will be used to generate the recall plasmid you can use something like the below command:

./clonrecall oligo -s GCAATATGCGGTACGATTCG -n lin1

By default the oligos command will print the comma separated sequences to stdout. These can be directly copied and pasted into IDT's bulk input.

You may also specify and output file with -o/--output.

Plasmids

Similarly you can generate an annotated recall vector with a 3x barcode array. In this case -o/--output is specifying a directory to save all generated .gb files.

./clonrecall plasmid -s ACGGGTAGACCATACGATGC -n lin2 -o recall-vectors