Diabetes+Dataset+.html

<!DOCTYPE html>
<html>
<head><meta charset="utf-8" />
<title>Diabetes Dataset </title>

<script src="https://cdnjs.cloudflare.com/ajax/libs/require.js/2.1.10/require.min.js"></script>
<script src="https://cdnjs.cloudflare.com/ajax/libs/jquery/2.0.3/jquery.min.js"></script>

<style type="text/css">
    /*!
*
* Twitter Bootstrap
*
*/
/*!
 * Bootstrap v3.3.6 (http://getbootstrap.com)
 * Copyright 2011-2015 Twitter, Inc.
 * Licensed under MIT (https://github.com/twbs/bootstrap/blob/master/LICENSE)
 */
/*! normalize.css v3.0.3 | MIT License | github.com/necolas/normalize.css */
html {
  font-family: sans-serif;
  -ms-text-size-adjust: 100%;
  -webkit-text-size-adjust: 100%;
}
body {
  margin: 0;
}
article,
aside,
details,
figcaption,
figure,
footer,
header,
hgroup,
main,
menu,
nav,
section,
summary {
  display: block;
}
audio,
canvas,
progress,
video {
  display: inline-block;
  vertical-align: baseline;
}
audio:not([controls]) {
  display: none;
  height: 0;
}
[hidden],
template {
  display: none;
}
a {
  background-color: transparent;
}
a:active,
a:hover {
  outline: 0;
}
abbr[title] {
  border-bottom: 1px dotted;
}
b,
strong {
  font-weight: bold;
}
dfn {
  font-style: italic;
}
h1 {
  font-size: 2em;
  margin: 0.67em 0;
}
mark {
  background: #ff0;
  color: #000;
}
small {
  font-size: 80%;
}
sub,
sup {
  font-size: 75%;
  line-height: 0;
  position: relative;
  vertical-align: baseline;
}
sup {
  top: -0.5em;
}
sub {
  bottom: -0.25em;
}
img {
  border: 0;
}
svg:not(:root) {
  overflow: hidden;
}
figure {
  margin: 1em 40px;
}
hr {
  box-sizing: content-box;
  height: 0;
}
pre {
  overflow: auto;
}
code,
kbd,
pre,
samp {
  font-family: monospace, monospace;
  font-size: 1em;
}
button,
input,
optgroup,
select,
textarea {
  color: inherit;
  font: inherit;
  margin: 0;
}
button {
  overflow: visible;
}
button,
select {
  text-transform: none;
}
button,
html input[type="button"],
input[type="reset"],
input[type="submit"] {
  -webkit-appearance: button;
  cursor: pointer;
}
button[disabled],
html input[disabled] {
  cursor: default;
}
button::-moz-focus-inner,
input::-moz-focus-inner {
  border: 0;
  padding: 0;
}
input {
  line-height: normal;
}
input[type="checkbox"],
input[type="radio"] {
  box-sizing: border-box;
  padding: 0;
}
input[type="number"]::-webkit-inner-spin-button,
input[type="number"]::-webkit-outer-spin-button {
  height: auto;
}
input[type="search"] {
  -webkit-appearance: textfield;
  box-sizing: content-box;
}
input[type="search"]::-webkit-search-cancel-button,
input[type="search"]::-webkit-search-decoration {
  -webkit-appearance: none;
}
fieldset {
  border: 1px solid #c0c0c0;
  margin: 0 2px;
  padding: 0.35em 0.625em 0.75em;
}
legend {
  border: 0;
  padding: 0;
}
textarea {
  overflow: auto;
}
optgroup {
  font-weight: bold;
}
table {
  border-collapse: collapse;
  border-spacing: 0;
}
td,
th {
  padding: 0;
}
/*! Source: https://github.com/h5bp/html5-boilerplate/blob/master/src/css/main.css */
@media print {
  *,
  *:before,
  *:after {
    background: transparent !important;
    color: #000 !important;
    box-shadow: none !important;
    text-shadow: none !important;
  }
  a,
  a:visited {
    text-decoration: underline;
  }
  a[href]:after {
    content: " (" attr(href) ")";
  }
  abbr[title]:after {
    content: " (" attr(title) ")";
  }
  a[href^="#"]:after,
  a[href^="javascript:"]:after {
    content: "";
  }
  pre,
  blockquote {
    border: 1px solid #999;
    page-break-inside: avoid;
  }
  thead {
    display: table-header-group;
  }
  tr,
  img {
    page-break-inside: avoid;
  }
  img {
    max-width: 100% !important;
  }
  p,
  h2,
  h3 {
    orphans: 3;
    widows: 3;
  }
  h2,
  h3 {
    page-break-after: avoid;
  }
  .navbar {
    display: none;
  }
  .btn > .caret,
  .dropup > .btn > .caret {
    border-top-color: #000 !important;
  }
  .label {
    border: 1px solid #000;
  }
  .table {
    border-collapse: collapse !important;
  }
  .table td,
  .table th {
    background-color: #fff !important;
  }
  .table-bordered th,
  .table-bordered td {
    border: 1px solid #ddd !important;
  }
}
@font-face {
  font-family: 'Glyphicons Halflings';
  src: url('../components/bootstrap/fonts/glyphicons-halflings-regular.eot');
  src: url('../components/bootstrap/fonts/glyphicons-halflings-regular.eot?#iefix') format('embedded-opentype'), url('../components/bootstrap/fonts/glyphicons-halflings-regular.woff2') format('woff2'), url('../components/bootstrap/fonts/glyphicons-halflings-regular.woff') format('woff'), url('../components/bootstrap/fonts/glyphicons-halflings-regular.ttf') format('truetype'), url('../components/bootstrap/fonts/glyphicons-halflings-regular.svg#glyphicons_halflingsregular') format('svg');
}
.glyphicon {
  position: relative;
  top: 1px;
  display: inline-block;
  font-family: 'Glyphicons Halflings';
  font-style: normal;
  font-weight: normal;
  line-height: 1;
  -webkit-font-smoothing: antialiased;
  -moz-osx-font-smoothing: grayscale;
}
.glyphicon-asterisk:before {
  content: "\002a";
}
.glyphicon-plus:before {
  content: "\002b";
}
.glyphicon-euro:before,
.glyphicon-eur:before {
  content: "\20ac";
}
.glyphicon-minus:before {
  content: "\2212";
}
.glyphicon-cloud:before {
  content: "\2601";
}
.glyphicon-envelope:before {
  content: "\2709";
}
.glyphicon-pencil:before {
  content: "\270f";
}
.glyphicon-glass:before {
  content: "\e001";
}
.glyphicon-music:before {
  content: "\e002";
}
.glyphicon-search:before {
  content: "\e003";
}
.glyphicon-heart:before {
  content: "\e005";
}
.glyphicon-star:before {
  content: "\e006";
}
.glyphicon-star-empty:before {
  content: "\e007";
}
.glyphicon-user:before {
  content: "\e008";
}
.glyphicon-film:before {
  content: "\e009";
}
.glyphicon-th-large:before {
  content: "\e010";
}
.glyphicon-th:before {
  content: "\e011";
}
.glyphicon-th-list:before {
  content: "\e012";
}
.glyphicon-ok:before {
  content: "\e013";
}
.glyphicon-remove:before {
  content: "\e014";
}
.glyphicon-zoom-in:before {
  content: "\e015";
}
.glyphicon-zoom-out:before {
  content: "\e016";
}
.glyphicon-off:before {
  content: "\e017";
}
.glyphicon-signal:before {
  content: "\e018";
}
.glyphicon-cog:before {
  content: "\e019";
}
.glyphicon-trash:before {
  content: "\e020";
}
.glyphicon-home:before {
  content: "\e021";
}
.glyphicon-file:before {
  content: "\e022";
}
.glyphicon-time:before {
  content: "\e023";
}
.glyphicon-road:before {
  content: "\e024";
}
.glyphicon-download-alt:before {
  content: "\e025";
}
.glyphicon-download:before {
  content: "\e026";
}
.glyphicon-upload:before {
  content: "\e027";
}
.glyphicon-inbox:before {
  content: "\e028";
}
.glyphicon-play-circle:before {
  content: "\e029";
}
.glyphicon-repeat:before {
  content: "\e030";
}
.glyphicon-refresh:before {
  content: "\e031";
}
.glyphicon-list-alt:before {
  content: "\e032";
}
.glyphicon-lock:before {
  content: "\e033";
}
.glyphicon-flag:before {
  content: "\e034";
}
.glyphicon-headphones:before {
  content: "\e035";
}
.glyphicon-volume-off:before {
  content: "\e036";
}
.glyphicon-volume-down:before {
  content: "\e037";
}
.glyphicon-volume-up:before {
  content: "\e038";
}
.glyphicon-qrcode:before {
  content: "\e039";
}
.glyphicon-barcode:before {
  content: "\e040";
}
.glyphicon-tag:before {
  content: "\e041";
}
.glyphicon-tags:before {
  content: "\e042";
}
.glyphicon-book:before {
  content: "\e043";
}
.glyphicon-bookmark:before {
  content: "\e044";
}
.glyphicon-print:before {
  content: "\e045";
}
.glyphicon-camera:before {
  content: "\e046";
}
.glyphicon-font:before {
  content: "\e047";
}
.glyphicon-bold:before {
  content: "\e048";
}
.glyphicon-italic:before {
  content: "\e049";
}
.glyphicon-text-height:before {
  content: "\e050";
}
.glyphicon-text-width:before {
  content: "\e051";
}
.glyphicon-align-left:before {
  content: "\e052";
}
.glyphicon-align-center:before {
  content: "\e053";
}
.glyphicon-align-right:before {
  content: "\e054";
}
.glyphicon-align-justify:before {
  content: "\e055";
}
.glyphicon-list:before {
  content: "\e056";
}
.glyphicon-indent-left:before {
  content: "\e057";
}
.glyphicon-indent-right:before {
  content: "\e058";
}
.glyphicon-facetime-video:before {
  content: "\e059";
}
.glyphicon-picture:before {
  content: "\e060";
}
.glyphicon-map-marker:before {
  content: "\e062";
}
.glyphicon-adjust:before {
  content: "\e063";
}
.glyphicon-tint:before {
  content: "\e064";
}
.glyphicon-edit:before {
  content: "\e065";
}
.glyphicon-share:before {
  content: "\e066";
}
.glyphicon-check:before {
  content: "\e067";
}
.glyphicon-move:before {
  content: "\e068";
}
.glyphicon-step-backward:before {
  content: "\e069";
}
.glyphicon-fast-backward:before {
  content: "\e070";
}
.glyphicon-backward:before {
  content: "\e071";
}
.glyphicon-play:before {
  content: "\e072";
}
.glyphicon-pause:before {
  content: "\e073";
}
.glyphicon-stop:before {
  content: "\e074";
}
.glyphicon-forward:before {
  content: "\e075";
}
.glyphicon-fast-forward:before {
  content: "\e076";
}
.glyphicon-step-forward:before {
  content: "\e077";
}
.glyphicon-eject:before {
  content: "\e078";
}
.glyphicon-chevron-left:before {
  content: "\e079";
}
.glyphicon-chevron-right:before {
  content: "\e080";
}
.glyphicon-plus-sign:before {
  content: "\e081";
}
.glyphicon-minus-sign:before {
  content: "\e082";
}
.glyphicon-remove-sign:before {
  content: "\e083";
}
.glyphicon-ok-sign:before {
  content: "\e084";
}
.glyphicon-question-sign:before {
  content: "\e085";
}
.glyphicon-info-sign:before {
  content: "\e086";
}
.glyphicon-screenshot:before {
  content: "\e087";
}
.glyphicon-remove-circle:before {
  content: "\e088";
}
.glyphicon-ok-circle:before {
  content: "\e089";
}
.glyphicon-ban-circle:before {
  content: "\e090";
}
.glyphicon-arrow-left:before {
  content: "\e091";
}
.glyphicon-arrow-right:before {
  content: "\e092";
}
.glyphicon-arrow-up:before {
  content: "\e093";
}
.glyphicon-arrow-down:before {
  content: "\e094";
}
.glyphicon-share-alt:before {
  content: "\e095";
}
.glyphicon-resize-full:before {
  content: "\e096";
}
.glyphicon-resize-small:before {
  content: "\e097";
}
.glyphicon-exclamation-sign:before {
  content: "\e101";
}
.glyphicon-gift:before {
  content: "\e102";
}
.glyphicon-leaf:before {
  content: "\e103";
}
.glyphicon-fire:before {
  content: "\e104";
}
.glyphicon-eye-open:before {
  content: "\e105";
}
.glyphicon-eye-close:before {
  content: "\e106";
}
.glyphicon-warning-sign:before {
  content: "\e107";
}
.glyphicon-plane:before {
  content: "\e108";
}
.glyphicon-calendar:before {
  content: "\e109";
}
.glyphicon-random:before {
  content: "\e110";
}
.glyphicon-comment:before {
  content: "\e111";
}
.glyphicon-magnet:before {
  content: "\e112";
}
.glyphicon-chevron-up:before {
  content: "\e113";
}
.glyphicon-chevron-down:before {
  content: "\e114";
}
.glyphicon-retweet:before {
  content: "\e115";
}
.glyphicon-shopping-cart:before {
  content: "\e116";
}
.glyphicon-folder-close:before {
  content: "\e117";
}
.glyphicon-folder-open:before {
  content: "\e118";
}
.glyphicon-resize-vertical:before {
  content: "\e119";
}
.glyphicon-resize-horizontal:before {
  content: "\e120";
}
.glyphicon-hdd:before {
  content: "\e121";
}
.glyphicon-bullhorn:before {
  content: "\e122";
}
.glyphicon-bell:before {
  content: "\e123";
}
.glyphicon-certificate:before {
  content: "\e124";
}
.glyphicon-thumbs-up:before {
  content: "\e125";
}
.glyphicon-thumbs-down:before {
  content: "\e126";
}
.glyphicon-hand-right:before {
  content: "\e127";
}
.glyphicon-hand-left:before {
  content: "\e128";
}
.glyphicon-hand-up:before {
  content: "\e129";
}
.glyphicon-hand-down:before {
  content: "\e130";
}
.glyphicon-circle-arrow-right:before {
  content: "\e131";
}
.glyphicon-circle-arrow-left:before {
  content: "\e132";
}
.glyphicon-circle-arrow-up:before {
  content: "\e133";
}
.glyphicon-circle-arrow-down:before {
  content: "\e134";
}
.glyphicon-globe:before {
  content: "\e135";
}
.glyphicon-wrench:before {
  content: "\e136";
}
.glyphicon-tasks:before {
  content: "\e137";
}
.glyphicon-filter:before {
  content: "\e138";
}
.glyphicon-briefcase:before {
  content: "\e139";
}
.glyphicon-fullscreen:before {
  content: "\e140";
}
.glyphicon-dashboard:before {
  content: "\e141";
}
.glyphicon-paperclip:before {
  content: "\e142";
}
.glyphicon-heart-empty:before {
  content: "\e143";
}
.glyphicon-link:before {
  content: "\e144";
}
.glyphicon-phone:before {
  content: "\e145";
}
.glyphicon-pushpin:before {
  content: "\e146";
}
.glyphicon-usd:before {
  content: "\e148";
}
.glyphicon-gbp:before {
  content: "\e149";
}
.glyphicon-sort:before {
  content: "\e150";
}
.glyphicon-sort-by-alphabet:before {
  content: "\e151";
}
.glyphicon-sort-by-alphabet-alt:before {
  content: "\e152";
}
.glyphicon-sort-by-order:before {
  content: "\e153";
}
.glyphicon-sort-by-order-alt:before {
  content: "\e154";
}
.glyphicon-sort-by-attributes:before {
  content: "\e155";
}
.glyphicon-sort-by-attributes-alt:before {
  content: "\e156";
}
.glyphicon-unchecked:before {
  content: "\e157";
}
.glyphicon-expand:before {
  content: "\e158";
}
.glyphicon-collapse-down:before {
  content: "\e159";
}
.glyphicon-collapse-up:before {
  content: "\e160";
}
.glyphicon-log-in:before {
  content: "\e161";
}
.glyphicon-flash:before {
  content: "\e162";
}
.glyphicon-log-out:before {
  content: "\e163";
}
.glyphicon-new-window:before {
  content: "\e164";
}
.glyphicon-record:before {
  content: "\e165";
}
.glyphicon-save:before {
  content: "\e166";
}
.glyphicon-open:before {
  content: "\e167";
}
.glyphicon-saved:before {
  content: "\e168";
}
.glyphicon-import:before {
  content: "\e169";
}
.glyphicon-export:before {
  content: "\e170";
}
.glyphicon-send:before {
  content: "\e171";
}
.glyphicon-floppy-disk:before {
  content: "\e172";
}
.glyphicon-floppy-saved:before {
  content: "\e173";
}
.glyphicon-floppy-remove:before {
  content: "\e174";
}
.glyphicon-floppy-save:before {
  content: "\e175";
}
.glyphicon-floppy-open:before {
  content: "\e176";
}
.glyphicon-credit-card:before {
  content: "\e177";
}
.glyphicon-transfer:before {
  content: "\e178";
}
.glyphicon-cutlery:before {
  content: "\e179";
}
.glyphicon-header:before {
  content: "\e180";
}
.glyphicon-compressed:before {
  content: "\e181";
}
.glyphicon-earphone:before {
  content: "\e182";
}
.glyphicon-phone-alt:before {
  content: "\e183";
}
.glyphicon-tower:before {
  content: "\e184";
}
.glyphicon-stats:before {
  content: "\e185";
}
.glyphicon-sd-video:before {
  content: "\e186";
}
.glyphicon-hd-video:before {
  content: "\e187";
}
.glyphicon-subtitles:before {
  content: "\e188";
}
.glyphicon-sound-stereo:before {
  content: "\e189";
}
.glyphicon-sound-dolby:before {
  content: "\e190";
}
.glyphicon-sound-5-1:before {
  content: "\e191";
}
.glyphicon-sound-6-1:before {
  content: "\e192";
}
.glyphicon-sound-7-1:before {
  content: "\e193";
}
.glyphicon-copyright-mark:before {
  content: "\e194";
}
.glyphicon-registration-mark:before {
  content: "\e195";
}
.glyphicon-cloud-download:before {
  content: "\e197";
}
.glyphicon-cloud-upload:before {
  content: "\e198";
}
.glyphicon-tree-conifer:before {
  content: "\e199";
}
.glyphicon-tree-deciduous:before {
  content: "\e200";
}
.glyphicon-cd:before {
  content: "\e201";
}
.glyphicon-save-file:before {
  content: "\e202";
}
.glyphicon-open-file:before {
  content: "\e203";
}
.glyphicon-level-up:before {
  content: "\e204";
}
.glyphicon-copy:before {
  content: "\e205";
}
.glyphicon-paste:before {
  content: "\e206";
}
.glyphicon-alert:before {
  content: "\e209";
}
.glyphicon-equalizer:before {
  content: "\e210";
}
.glyphicon-king:before {
  content: "\e211";
}
.glyphicon-queen:before {
  content: "\e212";
}
.glyphicon-pawn:before {
  content: "\e213";
}
.glyphicon-bishop:before {
  content: "\e214";
}
.glyphicon-knight:before {
  content: "\e215";
}
.glyphicon-baby-formula:before {
  content: "\e216";
}
.glyphicon-tent:before {
  content: "\26fa";
}
.glyphicon-blackboard:before {
  content: "\e218";
}
.glyphicon-bed:before {
  content: "\e219";
}
.glyphicon-apple:before {
  content: "\f8ff";
}
.glyphicon-erase:before {
  content: "\e221";
}
.glyphicon-hourglass:before {
  content: "\231b";
}
.glyphicon-lamp:before {
  content: "\e223";
}
.glyphicon-duplicate:before {
  content: "\e224";
}
.glyphicon-piggy-bank:before {
  content: "\e225";
}
.glyphicon-scissors:before {
  content: "\e226";
}
.glyphicon-bitcoin:before {
  content: "\e227";
}
.glyphicon-btc:before {
  content: "\e227";
}
.glyphicon-xbt:before {
  content: "\e227";
}
.glyphicon-yen:before {
  content: "\00a5";
}
.glyphicon-jpy:before {
  content: "\00a5";
}
.glyphicon-ruble:before {
  content: "\20bd";
}
.glyphicon-rub:before {
  content: "\20bd";
}
.glyphicon-scale:before {
  content: "\e230";
}
.glyphicon-ice-lolly:before {
  content: "\e231";
}
.glyphicon-ice-lolly-tasted:before {
  content: "\e232";
}
.glyphicon-education:before {
  content: "\e233";
}
.glyphicon-option-horizontal:before {
  content: "\e234";
}
.glyphicon-option-vertical:before {
  content: "\e235";
}
.glyphicon-menu-hamburger:before {
  content: "\e236";
}
.glyphicon-modal-window:before {
  content: "\e237";
}
.glyphicon-oil:before {
  content: "\e238";
}
.glyphicon-grain:before {
  content: "\e239";
}
.glyphicon-sunglasses:before {
  content: "\e240";
}
.glyphicon-text-size:before {
  content: "\e241";
}
.glyphicon-text-color:before {
  content: "\e242";
}
.glyphicon-text-background:before {
  content: "\e243";
}
.glyphicon-object-align-top:before {
  content: "\e244";
}
.glyphicon-object-align-bottom:before {
  content: "\e245";
}
.glyphicon-object-align-horizontal:before {
  content: "\e246";
}
.glyphicon-object-align-left:before {
  content: "\e247";
}
.glyphicon-object-align-vertical:before {
  content: "\e248";
}
.glyphicon-object-align-right:before {
  content: "\e249";
}
.glyphicon-triangle-right:before {
  content: "\e250";
}
.glyphicon-triangle-left:before {
  content: "\e251";
}
.glyphicon-triangle-bottom:before {
  content: "\e252";
}
.glyphicon-triangle-top:before {
  content: "\e253";
}
.glyphicon-console:before {
  content: "\e254";
}
.glyphicon-superscript:before {
  content: "\e255";
}
.glyphicon-subscript:before {
  content: "\e256";
}
.glyphicon-menu-left:before {
  content: "\e257";
}
.glyphicon-menu-right:before {
  content: "\e258";
}
.glyphicon-menu-down:before {
  content: "\e259";
}
.glyphicon-menu-up:before {
  content: "\e260";
}
* {
  -webkit-box-sizing: border-box;
  -moz-box-sizing: border-box;
  box-sizing: border-box;
}
*:before,
*:after {
  -webkit-box-sizing: border-box;
  -moz-box-sizing: border-box;
  box-sizing: border-box;
}
html {
  font-size: 10px;
  -webkit-tap-highlight-color: rgba(0, 0, 0, 0);
}
body {
  font-family: "Helvetica Neue", Helvetica, Arial, sans-serif;
  font-size: 13px;
  line-height: 1.42857143;
  color: #000;
  background-color: #fff;
}
input,
button,
select,
textarea {
  font-family: inherit;
  font-size: inherit;
  line-height: inherit;
}
a {
  color: #337ab7;
  text-decoration: none;
}
a:hover,
a:focus {
  color: #23527c;
  text-decoration: underline;
}
a:focus {
  outline: thin dotted;
  outline: 5px auto -webkit-focus-ring-color;
  outline-offset: -2px;
}
figure {
  margin: 0;
}
img {
  vertical-align: middle;
}
.img-responsive,
.thumbnail > img,
.thumbnail a > img,
.carousel-inner > .item > img,
.carousel-inner > .item > a > img {
  display: block;
  max-width: 100%;
  height: auto;
}
.img-rounded {
  border-radius: 3px;
}
.img-thumbnail {
  padding: 4px;
  line-height: 1.42857143;
  background-color: #fff;
  border: 1px solid #ddd;
  border-radius: 2px;
  -webkit-transition: all 0.2s ease-in-out;
  -o-transition: all 0.2s ease-in-out;
  transition: all 0.2s ease-in-out;
  display: inline-block;
  max-width: 100%;
  height: auto;
}
.img-circle {
  border-radius: 50%;
}
hr {
  margin-top: 18px;
  margin-bottom: 18px;
  border: 0;
  border-top: 1px solid #eeeeee;
}
.sr-only {
  position: absolute;
  width: 1px;
  height: 1px;
  margin: -1px;
  padding: 0;
  overflow: hidden;
  clip: rect(0, 0, 0, 0);
  border: 0;
}
.sr-only-focusable:active,
.sr-only-focusable:focus {
  position: static;
  width: auto;
  height: auto;
  margin: 0;
  overflow: visible;
  clip: auto;
}
[role="button"] {
  cursor: pointer;
}
h1,
h2,
h3,
h4,
h5,
h6,
.h1,
.h2,
.h3,
.h4,
.h5,
.h6 {
  font-family: inherit;
  font-weight: 500;
  line-height: 1.1;
  color: inherit;
}
h1 small,
h2 small,
h3 small,
h4 small,
h5 small,
h6 small,
.h1 small,
.h2 small,
.h3 small,
.h4 small,
.h5 small,
.h6 small,
h1 .small,
h2 .small,
h3 .small,
h4 .small,
h5 .small,
h6 .small,
.h1 .small,
.h2 .small,
.h3 .small,
.h4 .small,
.h5 .small,
.h6 .small {
  font-weight: normal;
  line-height: 1;
  color: #777777;
}
h1,
.h1,
h2,
.h2,
h3,
.h3 {
  margin-top: 18px;
  margin-bottom: 9px;
}
h1 small,
.h1 small,
h2 small,
.h2 small,
h3 small,
.h3 small,
h1 .small,
.h1 .small,
h2 .small,
.h2 .small,
h3 .small,
.h3 .small {
  font-size: 65%;
}
h4,
.h4,
h5,
.h5,
h6,
.h6 {
  margin-top: 9px;
  margin-bottom: 9px;
}
h4 small,
.h4 small,
h5 small,
.h5 small,
h6 small,
.h6 small,
h4 .small,
.h4 .small,
h5 .small,
.h5 .small,
h6 .small,
.h6 .small {
  font-size: 75%;
}
h1,
.h1 {
  font-size: 33px;
}
h2,
.h2 {
  font-size: 27px;
}
h3,
.h3 {
  font-size: 23px;
}
h4,
.h4 {
  font-size: 17px;
}
h5,
.h5 {
  font-size: 13px;
}
h6,
.h6 {
  font-size: 12px;
}
p {
  margin: 0 0 9px;
}
.lead {
  margin-bottom: 18px;
  font-size: 14px;
  font-weight: 300;
  line-height: 1.4;
}
@media (min-width: 768px) {
  .lead {
    font-size: 19.5px;
  }
}
small,
.small {
  font-size: 92%;
}
mark,
.mark {
  background-color: #fcf8e3;
  padding: .2em;
}
.text-left {
  text-align: left;
}
.text-right {
  text-align: right;
}
.text-center {
  text-align: center;
}
.text-justify {
  text-align: justify;
}
.text-nowrap {
  white-space: nowrap;
}
.text-lowercase {
  text-transform: lowercase;
}
.text-uppercase {
  text-transform: uppercase;
}
.text-capitalize {
  text-transform: capitalize;
}
.text-muted {
  color: #777777;
}
.text-primary {
  color: #337ab7;
}
a.text-primary:hover,
a.text-primary:focus {
  color: #286090;
}
.text-success {
  color: #3c763d;
}
a.text-success:hover,
a.text-success:focus {
  color: #2b542c;
}
.text-info {
  color: #31708f;
}
a.text-info:hover,
a.text-info:focus {
  color: #245269;
}
.text-warning {
  color: #8a6d3b;
}
a.text-warning:hover,
a.text-warning:focus {
  color: #66512c;
}
.text-danger {
  color: #a94442;
}
a.text-danger:hover,
a.text-danger:focus {
  color: #843534;
}
.bg-primary {
  color: #fff;
  background-color: #337ab7;
}
a.bg-primary:hover,
a.bg-primary:focus {
  background-color: #286090;
}
.bg-success {
  background-color: #dff0d8;
}
a.bg-success:hover,
a.bg-success:focus {
  background-color: #c1e2b3;
}
.bg-info {
  background-color: #d9edf7;
}
a.bg-info:hover,
a.bg-info:focus {
  background-color: #afd9ee;
}
.bg-warning {
  background-color: #fcf8e3;
}
a.bg-warning:hover,
a.bg-warning:focus {
  background-color: #f7ecb5;
}
.bg-danger {
  background-color: #f2dede;
}
a.bg-danger:hover,
a.bg-danger:focus {
  background-color: #e4b9b9;
}
.page-header {
  padding-bottom: 8px;
  margin: 36px 0 18px;
  border-bottom: 1px solid #eeeeee;
}
ul,
ol {
  margin-top: 0;
  margin-bottom: 9px;
}
ul ul,
ol ul,
ul ol,
ol ol {
  margin-bottom: 0;
}
.list-unstyled {
  padding-left: 0;
  list-style: none;
}
.list-inline {
  padding-left: 0;
  list-style: none;
  margin-left: -5px;
}
.list-inline > li {
  display: inline-block;
  padding-left: 5px;
  padding-right: 5px;
}
dl {
  margin-top: 0;
  margin-bottom: 18px;
}
dt,
dd {
  line-height: 1.42857143;
}
dt {
  font-weight: bold;
}
dd {
  margin-left: 0;
}
@media (min-width: 541px) {
  .dl-horizontal dt {
    float: left;
    width: 160px;
    clear: left;
    text-align: right;
    overflow: hidden;
    text-overflow: ellipsis;
    white-space: nowrap;
  }
  .dl-horizontal dd {
    margin-left: 180px;
  }
}
abbr[title],
abbr[data-original-title] {
  cursor: help;
  border-bottom: 1px dotted #777777;
}
.initialism {
  font-size: 90%;
  text-transform: uppercase;
}
blockquote {
  padding: 9px 18px;
  margin: 0 0 18px;
  font-size: inherit;
  border-left: 5px solid #eeeeee;
}
blockquote p:last-child,
blockquote ul:last-child,
blockquote ol:last-child {
  margin-bottom: 0;
}
blockquote footer,
blockquote small,
blockquote .small {
  display: block;
  font-size: 80%;
  line-height: 1.42857143;
  color: #777777;
}
blockquote footer:before,
blockquote small:before,
blockquote .small:before {
  content: '\2014 \00A0';
}
.blockquote-reverse,
blockquote.pull-right {
  padding-right: 15px;
  padding-left: 0;
  border-right: 5px solid #eeeeee;
  border-left: 0;
  text-align: right;
}
.blockquote-reverse footer:before,
blockquote.pull-right footer:before,
.blockquote-reverse small:before,
blockquote.pull-right small:before,
.blockquote-reverse .small:before,
blockquote.pull-right .small:before {
  content: '';
}
.blockquote-reverse footer:after,
blockquote.pull-right footer:after,
.blockquote-reverse small:after,
blockquote.pull-right small:after,
.blockquote-reverse .small:after,
blockquote.pull-right .small:after {
  content: '\00A0 \2014';
}
address {
  margin-bottom: 18px;
  font-style: normal;
  line-height: 1.42857143;
}
code,
kbd,
pre,
samp {
  font-family: monospace;
}
code {
  padding: 2px 4px;
  font-size: 90%;
  color: #c7254e;
  background-color: #f9f2f4;
  border-radius: 2px;
}
kbd {
  padding: 2px 4px;
  font-size: 90%;
  color: #888;
  background-color: transparent;
  border-radius: 1px;
  box-shadow: inset 0 -1px 0 rgba(0, 0, 0, 0.25);
}
kbd kbd {
  padding: 0;
  font-size: 100%;
  font-weight: bold;
  box-shadow: none;
}
pre {
  display: block;
  padding: 8.5px;
  margin: 0 0 9px;
  font-size: 12px;
  line-height: 1.42857143;
  word-break: break-all;
  word-wrap: break-word;
  color: #333333;
  background-color: #f5f5f5;
  border: 1px solid #ccc;
  border-radius: 2px;
}
pre code {
  padding: 0;
  font-size: inherit;
  color: inherit;
  white-space: pre-wrap;
  background-color: transparent;
  border-radius: 0;
}
.pre-scrollable {
  max-height: 340px;
  overflow-y: scroll;
}
.container {
  margin-right: auto;
  margin-left: auto;
  padding-left: 0px;
  padding-right: 0px;
}
@media (min-width: 768px) {
  .container {
    width: 768px;
  }
}
@media (min-width: 992px) {
  .container {
    width: 940px;
  }
}
@media (min-width: 1200px) {
  .container {
    width: 1140px;
  }
}
.container-fluid {
  margin-right: auto;
  margin-left: auto;
  padding-left: 0px;
  padding-right: 0px;
}
.row {
  margin-left: 0px;
  margin-right: 0px;
}
.col-xs-1, .col-sm-1, .col-md-1, .col-lg-1, .col-xs-2, .col-sm-2, .col-md-2, .col-lg-2, .col-xs-3, .col-sm-3, .col-md-3, .col-lg-3, .col-xs-4, .col-sm-4, .col-md-4, .col-lg-4, .col-xs-5, .col-sm-5, .col-md-5, .col-lg-5, .col-xs-6, .col-sm-6, .col-md-6, .col-lg-6, .col-xs-7, .col-sm-7, .col-md-7, .col-lg-7, .col-xs-8, .col-sm-8, .col-md-8, .col-lg-8, .col-xs-9, .col-sm-9, .col-md-9, .col-lg-9, .col-xs-10, .col-sm-10, .col-md-10, .col-lg-10, .col-xs-11, .col-sm-11, .col-md-11, .col-lg-11, .col-xs-12, .col-sm-12, .col-md-12, .col-lg-12 {
  position: relative;
  min-height: 1px;
  padding-left: 0px;
  padding-right: 0px;
}
.col-xs-1, .col-xs-2, .col-xs-3, .col-xs-4, .col-xs-5, .col-xs-6, .col-xs-7, .col-xs-8, .col-xs-9, .col-xs-10, .col-xs-11, .col-xs-12 {
  float: left;
}
.col-xs-12 {
  width: 100%;
}
.col-xs-11 {
  width: 91.66666667%;
}
.col-xs-10 {
  width: 83.33333333%;
}
.col-xs-9 {
  width: 75%;
}
.col-xs-8 {
  width: 66.66666667%;
}
.col-xs-7 {
  width: 58.33333333%;
}
.col-xs-6 {
  width: 50%;
}
.col-xs-5 {
  width: 41.66666667%;
}
.col-xs-4 {
  width: 33.33333333%;
}
.col-xs-3 {
  width: 25%;
}
.col-xs-2 {
  width: 16.66666667%;
}
.col-xs-1 {
  width: 8.33333333%;
}
.col-xs-pull-12 {
  right: 100%;
}
.col-xs-pull-11 {
  right: 91.66666667%;
}
.col-xs-pull-10 {
  right: 83.33333333%;
}
.col-xs-pull-9 {
  right: 75%;
}
.col-xs-pull-8 {
  right: 66.66666667%;
}
.col-xs-pull-7 {
  right: 58.33333333%;
}
.col-xs-pull-6 {
  right: 50%;
}
.col-xs-pull-5 {
  right: 41.66666667%;
}
.col-xs-pull-4 {
  right: 33.33333333%;
}
.col-xs-pull-3 {
  right: 25%;
}
.col-xs-pull-2 {
  right: 16.66666667%;
}
.col-xs-pull-1 {
  right: 8.33333333%;
}
.col-xs-pull-0 {
  right: auto;
}
.col-xs-push-12 {
  left: 100%;
}
.col-xs-push-11 {
  left: 91.66666667%;
}
.col-xs-push-10 {
  left: 83.33333333%;
}
.col-xs-push-9 {
  left: 75%;
}
.col-xs-push-8 {
  left: 66.66666667%;
}
.col-xs-push-7 {
  left: 58.33333333%;
}
.col-xs-push-6 {
  left: 50%;
}
.col-xs-push-5 {
  left: 41.66666667%;
}
.col-xs-push-4 {
  left: 33.33333333%;
}
.col-xs-push-3 {
  left: 25%;
}
.col-xs-push-2 {
  left: 16.66666667%;
}
.col-xs-push-1 {
  left: 8.33333333%;
}
.col-xs-push-0 {
  left: auto;
}
.col-xs-offset-12 {
  margin-left: 100%;
}
.col-xs-offset-11 {
  margin-left: 91.66666667%;
}
.col-xs-offset-10 {
  margin-left: 83.33333333%;
}
.col-xs-offset-9 {
  margin-left: 75%;
}
.col-xs-offset-8 {
  margin-left: 66.66666667%;
}
.col-xs-offset-7 {
  margin-left: 58.33333333%;
}
.col-xs-offset-6 {
  margin-left: 50%;
}
.col-xs-offset-5 {
  margin-left: 41.66666667%;
}
.col-xs-offset-4 {
  margin-left: 33.33333333%;
}
.col-xs-offset-3 {
  margin-left: 25%;
}
.col-xs-offset-2 {
  margin-left: 16.66666667%;
}
.col-xs-offset-1 {
  margin-left: 8.33333333%;
}
.col-xs-offset-0 {
  margin-left: 0%;
}
@media (min-width: 768px) {
  .col-sm-1, .col-sm-2, .col-sm-3, .col-sm-4, .col-sm-5, .col-sm-6, .col-sm-7, .col-sm-8, .col-sm-9, .col-sm-10, .col-sm-11, .col-sm-12 {
    float: left;
  }
  .col-sm-12 {
    width: 100%;
  }
  .col-sm-11 {
    width: 91.66666667%;
  }
  .col-sm-10 {
    width: 83.33333333%;
  }
  .col-sm-9 {
    width: 75%;
  }
  .col-sm-8 {
    width: 66.66666667%;
  }
  .col-sm-7 {
    width: 58.33333333%;
  }
  .col-sm-6 {
    width: 50%;
  }
  .col-sm-5 {
    width: 41.66666667%;
  }
  .col-sm-4 {
    width: 33.33333333%;
  }
  .col-sm-3 {
    width: 25%;
  }
  .col-sm-2 {
    width: 16.66666667%;
  }
  .col-sm-1 {
    width: 8.33333333%;
  }
  .col-sm-pull-12 {
    right: 100%;
  }
  .col-sm-pull-11 {
    right: 91.66666667%;
  }
  .col-sm-pull-10 {
    right: 83.33333333%;
  }
  .col-sm-pull-9 {
    right: 75%;
  }
  .col-sm-pull-8 {
    right: 66.66666667%;
  }
  .col-sm-pull-7 {
    right: 58.33333333%;
  }
  .col-sm-pull-6 {
    right: 50%;
  }
  .col-sm-pull-5 {
    right: 41.66666667%;
  }
  .col-sm-pull-4 {
    right: 33.33333333%;
  }
  .col-sm-pull-3 {
    right: 25%;
  }
  .col-sm-pull-2 {
    right: 16.66666667%;
  }
  .col-sm-pull-1 {
    right: 8.33333333%;
  }
  .col-sm-pull-0 {
    right: auto;
  }
  .col-sm-push-12 {
    left: 100%;
  }
  .col-sm-push-11 {
    left: 91.66666667%;
  }
  .col-sm-push-10 {
    left: 83.33333333%;
  }
  .col-sm-push-9 {
    left: 75%;
  }
  .col-sm-push-8 {
    left: 66.66666667%;
  }
  .col-sm-push-7 {
    left: 58.33333333%;
  }
  .col-sm-push-6 {
    left: 50%;
  }
  .col-sm-push-5 {
    left: 41.66666667%;
  }
  .col-sm-push-4 {
    left: 33.33333333%;
  }
  .col-sm-push-3 {
    left: 25%;
  }
  .col-sm-push-2 {
    left: 16.66666667%;
  }
  .col-sm-push-1 {
    left: 8.33333333%;
  }
  .col-sm-push-0 {
    left: auto;
  }
  .col-sm-offset-12 {
    margin-left: 100%;
  }
  .col-sm-offset-11 {
    margin-left: 91.66666667%;
  }
  .col-sm-offset-10 {
    margin-left: 83.33333333%;
  }
  .col-sm-offset-9 {
    margin-left: 75%;
  }
  .col-sm-offset-8 {
    margin-left: 66.66666667%;
  }
  .col-sm-offset-7 {
    margin-left: 58.33333333%;
  }
  .col-sm-offset-6 {
    margin-left: 50%;
  }
  .col-sm-offset-5 {
    margin-left: 41.66666667%;
  }
  .col-sm-offset-4 {
    margin-left: 33.33333333%;
  }
  .col-sm-offset-3 {
    margin-left: 25%;
  }
  .col-sm-offset-2 {
    margin-left: 16.66666667%;
  }
  .col-sm-offset-1 {
    margin-left: 8.33333333%;
  }
  .col-sm-offset-0 {
    margin-left: 0%;
  }
}
@media (min-width: 992px) {
  .col-md-1, .col-md-2, .col-md-3, .col-md-4, .col-md-5, .col-md-6, .col-md-7, .col-md-8, .col-md-9, .col-md-10, .col-md-11, .col-md-12 {
    float: left;
  }
  .col-md-12 {
    width: 100%;
  }
  .col-md-11 {
    width: 91.66666667%;
  }
  .col-md-10 {
    width: 83.33333333%;
  }
  .col-md-9 {
    width: 75%;
  }
  .col-md-8 {
    width: 66.66666667%;
  }
  .col-md-7 {
    width: 58.33333333%;
  }
  .col-md-6 {
    width: 50%;
  }
  .col-md-5 {
    width: 41.66666667%;
  }
  .col-md-4 {
    width: 33.33333333%;
  }
  .col-md-3 {
    width: 25%;
  }
  .col-md-2 {
    width: 16.66666667%;
  }
  .col-md-1 {
    width: 8.33333333%;
  }
  .col-md-pull-12 {
    right: 100%;
  }
  .col-md-pull-11 {
    right: 91.66666667%;
  }
  .col-md-pull-10 {
    right: 83.33333333%;
  }
  .col-md-pull-9 {
    right: 75%;
  }
  .col-md-pull-8 {
    right: 66.66666667%;
  }
  .col-md-pull-7 {
    right: 58.33333333%;
  }
  .col-md-pull-6 {
    right: 50%;
  }
  .col-md-pull-5 {
    right: 41.66666667%;
  }
  .col-md-pull-4 {
    right: 33.33333333%;
  }
  .col-md-pull-3 {
    right: 25%;
  }
  .col-md-pull-2 {
    right: 16.66666667%;
  }
  .col-md-pull-1 {
    right: 8.33333333%;
  }
  .col-md-pull-0 {
    right: auto;
  }
  .col-md-push-12 {
    left: 100%;
  }
  .col-md-push-11 {
    left: 91.66666667%;
  }
  .col-md-push-10 {
    left: 83.33333333%;
  }
  .col-md-push-9 {
    left: 75%;
  }
  .col-md-push-8 {
    left: 66.66666667%;
  }
  .col-md-push-7 {
    left: 58.33333333%;
  }
  .col-md-push-6 {
    left: 50%;
  }
  .col-md-push-5 {
    left: 41.66666667%;
  }
  .col-md-push-4 {
    left: 33.33333333%;
  }
  .col-md-push-3 {
    left: 25%;
  }
  .col-md-push-2 {
    left: 16.66666667%;
  }
  .col-md-push-1 {
    left: 8.33333333%;
  }
  .col-md-push-0 {
    left: auto;
  }
  .col-md-offset-12 {
    margin-left: 100%;
  }
  .col-md-offset-11 {
    margin-left: 91.66666667%;
  }
  .col-md-offset-10 {
    margin-left: 83.33333333%;
  }
  .col-md-offset-9 {
    margin-left: 75%;
  }
  .col-md-offset-8 {
    margin-left: 66.66666667%;
  }
  .col-md-offset-7 {
    margin-left: 58.33333333%;
  }
  .col-md-offset-6 {
    margin-left: 50%;
  }
  .col-md-offset-5 {
    margin-left: 41.66666667%;
  }
  .col-md-offset-4 {
    margin-left: 33.33333333%;
  }
  .col-md-offset-3 {
    margin-left: 25%;
  }
  .col-md-offset-2 {
    margin-left: 16.66666667%;
  }
  .col-md-offset-1 {
    margin-left: 8.33333333%;
  }
  .col-md-offset-0 {
    margin-left: 0%;
  }
}
@media (min-width: 1200px) {
  .col-lg-1, .col-lg-2, .col-lg-3, .col-lg-4, .col-lg-5, .col-lg-6, .col-lg-7, .col-lg-8, .col-lg-9, .col-lg-10, .col-lg-11, .col-lg-12 {
    float: left;
  }
  .col-lg-12 {
    width: 100%;
  }
  .col-lg-11 {
    width: 91.66666667%;
  }
  .col-lg-10 {
    width: 83.33333333%;
  }
  .col-lg-9 {
    width: 75%;
  }
  .col-lg-8 {
    width: 66.66666667%;
  }
  .col-lg-7 {
    width: 58.33333333%;
  }
  .col-lg-6 {
    width: 50%;
  }
  .col-lg-5 {
    width: 41.66666667%;
  }
  .col-lg-4 {
    width: 33.33333333%;
  }
  .col-lg-3 {
    width: 25%;
  }
  .col-lg-2 {
    width: 16.66666667%;
  }
  .col-lg-1 {
    width: 8.33333333%;
  }
  .col-lg-pull-12 {
    right: 100%;
  }
  .col-lg-pull-11 {
    right: 91.66666667%;
  }
  .col-lg-pull-10 {
    right: 83.33333333%;
  }
  .col-lg-pull-9 {
    right: 75%;
  }
  .col-lg-pull-8 {
    right: 66.66666667%;
  }
  .col-lg-pull-7 {
    right: 58.33333333%;
  }
  .col-lg-pull-6 {
    right: 50%;
  }
  .col-lg-pull-5 {
    right: 41.66666667%;
  }
  .col-lg-pull-4 {
    right: 33.33333333%;
  }
  .col-lg-pull-3 {
    right: 25%;
  }
  .col-lg-pull-2 {
    right: 16.66666667%;
  }
  .col-lg-pull-1 {
    right: 8.33333333%;
  }
  .col-lg-pull-0 {
    right: auto;
  }
  .col-lg-push-12 {
    left: 100%;
  }
  .col-lg-push-11 {
    left: 91.66666667%;
  }
  .col-lg-push-10 {
    left: 83.33333333%;
  }
  .col-lg-push-9 {
    left: 75%;
  }
  .col-lg-push-8 {
    left: 66.66666667%;
  }
  .col-lg-push-7 {
    left: 58.33333333%;
  }
  .col-lg-push-6 {
    left: 50%;
  }
  .col-lg-push-5 {
    left: 41.66666667%;
  }
  .col-lg-push-4 {
    left: 33.33333333%;
  }
  .col-lg-push-3 {
    left: 25%;
  }
  .col-lg-push-2 {
    left: 16.66666667%;
  }
  .col-lg-push-1 {
    left: 8.33333333%;
  }
  .col-lg-push-0 {
    left: auto;
  }
  .col-lg-offset-12 {
    margin-left: 100%;
  }
  .col-lg-offset-11 {
    margin-left: 91.66666667%;
  }
  .col-lg-offset-10 {
    margin-left: 83.33333333%;
  }
  .col-lg-offset-9 {
    margin-left: 75%;
  }
  .col-lg-offset-8 {
    margin-left: 66.66666667%;
  }
  .col-lg-offset-7 {
    margin-left: 58.33333333%;
  }
  .col-lg-offset-6 {
    margin-left: 50%;
  }
  .col-lg-offset-5 {
    margin-left: 41.66666667%;
  }
  .col-lg-offset-4 {
    margin-left: 33.33333333%;
  }
  .col-lg-offset-3 {
    margin-left: 25%;
  }
  .col-lg-offset-2 {
    margin-left: 16.66666667%;
  }
  .col-lg-offset-1 {
    margin-left: 8.33333333%;
  }
  .col-lg-offset-0 {
    margin-left: 0%;
  }
}
table {
  background-color: transparent;
}
caption {
  padding-top: 8px;
  padding-bottom: 8px;
  color: #777777;
  text-align: left;
}
th {
  text-align: left;
}
.table {
  width: 100%;
  max-width: 100%;
  margin-bottom: 18px;
}
.table > thead > tr > th,
.table > tbody > tr > th,
.table > tfoot > tr > th,
.table > thead > tr > td,
.table > tbody > tr > td,
.table > tfoot > tr > td {
  padding: 8px;
  line-height: 1.42857143;
  vertical-align: top;
  border-top: 1px solid #ddd;
}
.table > thead > tr > th {
  vertical-align: bottom;
  border-bottom: 2px solid #ddd;
}
.table > caption + thead > tr:first-child > th,
.table > colgroup + thead > tr:first-child > th,
.table > thead:first-child > tr:first-child > th,
.table > caption + thead > tr:first-child > td,
.table > colgroup + thead > tr:first-child > td,
.table > thead:first-child > tr:first-child > td {
  border-top: 0;
}
.table > tbody + tbody {
  border-top: 2px solid #ddd;
}
.table .table {
  background-color: #fff;
}
.table-condensed > thead > tr > th,
.table-condensed > tbody > tr > th,
.table-condensed > tfoot > tr > th,
.table-condensed > thead > tr > td,
.table-condensed > tbody > tr > td,
.table-condensed > tfoot > tr > td {
  padding: 5px;
}
.table-bordered {
  border: 1px solid #ddd;
}
.table-bordered > thead > tr > th,
.table-bordered > tbody > tr > th,
.table-bordered > tfoot > tr > th,
.table-bordered > thead > tr > td,
.table-bordered > tbody > tr > td,
.table-bordered > tfoot > tr > td {
  border: 1px solid #ddd;
}
.table-bordered > thead > tr > th,
.table-bordered > thead > tr > td {
  border-bottom-width: 2px;
}
.table-striped > tbody > tr:nth-of-type(odd) {
  background-color: #f9f9f9;
}
.table-hover > tbody > tr:hover {
  background-color: #f5f5f5;
}
table col[class*="col-"] {
  position: static;
  float: none;
  display: table-column;
}
table td[class*="col-"],
table th[class*="col-"] {
  position: static;
  float: none;
  display: table-cell;
}
.table > thead > tr > td.active,
.table > tbody > tr > td.active,
.table > tfoot > tr > td.active,
.table > thead > tr > th.active,
.table > tbody > tr > th.active,
.table > tfoot > tr > th.active,
.table > thead > tr.active > td,
.table > tbody > tr.active > td,
.table > tfoot > tr.active > td,
.table > thead > tr.active > th,
.table > tbody > tr.active > th,
.table > tfoot > tr.active > th {
  background-color: #f5f5f5;
}
.table-hover > tbody > tr > td.active:hover,
.table-hover > tbody > tr > th.active:hover,
.table-hover > tbody > tr.active:hover > td,
.table-hover > tbody > tr:hover > .active,
.table-hover > tbody > tr.active:hover > th {
  background-color: #e8e8e8;
}
.table > thead > tr > td.success,
.table > tbody > tr > td.success,
.table > tfoot > tr > td.success,
.table > thead > tr > th.success,
.table > tbody > tr > th.success,
.table > tfoot > tr > th.success,
.table > thead > tr.success > td,
.table > tbody > tr.success > td,
.table > tfoot > tr.success > td,
.table > thead > tr.success > th,
.table > tbody > tr.success > th,
.table > tfoot > tr.success > th {
  background-color: #dff0d8;
}
.table-hover > tbody > tr > td.success:hover,
.table-hover > tbody > tr > th.success:hover,
.table-hover > tbody > tr.success:hover > td,
.table-hover > tbody > tr:hover > .success,
.table-hover > tbody > tr.success:hover > th {
  background-color: #d0e9c6;
}
.table > thead > tr > td.info,
.table > tbody > tr > td.info,
.table > tfoot > tr > td.info,
.table > thead > tr > th.info,
.table > tbody > tr > th.info,
.table > tfoot > tr > th.info,
.table > thead > tr.info > td,
.table > tbody > tr.info > td,
.table > tfoot > tr.info > td,
.table > thead > tr.info > th,
.table > tbody > tr.info > th,
.table > tfoot > tr.info > th {
  background-color: #d9edf7;
}
.table-hover > tbody > tr > td.info:hover,
.table-hover > tbody > tr > th.info:hover,
.table-hover > tbody > tr.info:hover > td,
.table-hover > tbody > tr:hover > .info,
.table-hover > tbody > tr.info:hover > th {
  background-color: #c4e3f3;
}
.table > thead > tr > td.warning,
.table > tbody > tr > td.warning,
.table > tfoot > tr > td.warning,
.table > thead > tr > th.warning,
.table > tbody > tr > th.warning,
.table > tfoot > tr > th.warning,
.table > thead > tr.warning > td,
.table > tbody > tr.warning > td,
.table > tfoot > tr.warning > td,
.table > thead > tr.warning > th,
.table > tbody > tr.warning > th,
.table > tfoot > tr.warning > th {
  background-color: #fcf8e3;
}
.table-hover > tbody > tr > td.warning:hover,
.table-hover > tbody > tr > th.warning:hover,
.table-hover > tbody > tr.warning:hover > td,
.table-hover > tbody > tr:hover > .warning,
.table-hover > tbody > tr.warning:hover > th {
  background-color: #faf2cc;
}
.table > thead > tr > td.danger,
.table > tbody > tr > td.danger,
.table > tfoot > tr > td.danger,
.table > thead > tr > th.danger,
.table > tbody > tr > th.danger,
.table > tfoot > tr > th.danger,
.table > thead > tr.danger > td,
.table > tbody > tr.danger > td,
.table > tfoot > tr.danger > td,
.table > thead > tr.danger > th,
.table > tbody > tr.danger > th,
.table > tfoot > tr.danger > th {
  background-color: #f2dede;
}
.table-hover > tbody > tr > td.danger:hover,
.table-hover > tbody > tr > th.danger:hover,
.table-hover > tbody > tr.danger:hover > td,
.table-hover > tbody > tr:hover > .danger,
.table-hover > tbody > tr.danger:hover > th {
  background-color: #ebcccc;
}
.table-responsive {
  overflow-x: auto;
  min-height: 0.01%;
}
@media screen and (max-width: 767px) {
  .table-responsive {
    width: 100%;
    margin-bottom: 13.5px;
    overflow-y: hidden;
    -ms-overflow-style: -ms-autohiding-scrollbar;
    border: 1px solid #ddd;
  }
  .table-responsive > .table {
    margin-bottom: 0;
  }
  .table-responsive > .table > thead > tr > th,
  .table-responsive > .table > tbody > tr > th,
  .table-responsive > .table > tfoot > tr > th,
  .table-responsive > .table > thead > tr > td,
  .table-responsive > .table > tbody > tr > td,
  .table-responsive > .table > tfoot > tr > td {
    white-space: nowrap;
  }
  .table-responsive > .table-bordered {
    border: 0;
  }
  .table-responsive > .table-bordered > thead > tr > th:first-child,
  .table-responsive > .table-bordered > tbody > tr > th:first-child,
  .table-responsive > .table-bordered > tfoot > tr > th:first-child,
  .table-responsive > .table-bordered > thead > tr > td:first-child,
  .table-responsive > .table-bordered > tbody > tr > td:first-child,
  .table-responsive > .table-bordered > tfoot > tr > td:first-child {
    border-left: 0;
  }
  .table-responsive > .table-bordered > thead > tr > th:last-child,
  .table-responsive > .table-bordered > tbody > tr > th:last-child,
  .table-responsive > .table-bordered > tfoot > tr > th:last-child,
  .table-responsive > .table-bordered > thead > tr > td:last-child,
  .table-responsive > .table-bordered > tbody > tr > td:last-child,
  .table-responsive > .table-bordered > tfoot > tr > td:last-child {
    border-right: 0;
  }
  .table-responsive > .table-bordered > tbody > tr:last-child > th,
  .table-responsive > .table-bordered > tfoot > tr:last-child > th,
  .table-responsive > .table-bordered > tbody > tr:last-child > td,
  .table-responsive > .table-bordered > tfoot > tr:last-child > td {
    border-bottom: 0;
  }
}
fieldset {
  padding: 0;
  margin: 0;
  border: 0;
  min-width: 0;
}
legend {
  display: block;
  width: 100%;
  padding: 0;
  margin-bottom: 18px;
  font-size: 19.5px;
  line-height: inherit;
  color: #333333;
  border: 0;
  border-bottom: 1px solid #e5e5e5;
}
label {
  display: inline-block;
  max-width: 100%;
  margin-bottom: 5px;
  font-weight: bold;
}
input[type="search"] {
  -webkit-box-sizing: border-box;
  -moz-box-sizing: border-box;
  box-sizing: border-box;
}
input[type="radio"],
input[type="checkbox"] {
  margin: 4px 0 0;
  margin-top: 1px \9;
  line-height: normal;
}
input[type="file"] {
  display: block;
}
input[type="range"] {
  display: block;
  width: 100%;
}
select[multiple],
select[size] {
  height: auto;
}
input[type="file"]:focus,
input[type="radio"]:focus,
input[type="checkbox"]:focus {
  outline: thin dotted;
  outline: 5px auto -webkit-focus-ring-color;
  outline-offset: -2px;
}
output {
  display: block;
  padding-top: 7px;
  font-size: 13px;
  line-height: 1.42857143;
  color: #555555;
}
.form-control {
  display: block;
  width: 100%;
  height: 32px;
  padding: 6px 12px;
  font-size: 13px;
  line-height: 1.42857143;
  color: #555555;
  background-color: #fff;
  background-image: none;
  border: 1px solid #ccc;
  border-radius: 2px;
  -webkit-box-shadow: inset 0 1px 1px rgba(0, 0, 0, 0.075);
  box-shadow: inset 0 1px 1px rgba(0, 0, 0, 0.075);
  -webkit-transition: border-color ease-in-out .15s, box-shadow ease-in-out .15s;
  -o-transition: border-color ease-in-out .15s, box-shadow ease-in-out .15s;
  transition: border-color ease-in-out .15s, box-shadow ease-in-out .15s;
}
.form-control:focus {
  border-color: #66afe9;
  outline: 0;
  -webkit-box-shadow: inset 0 1px 1px rgba(0,0,0,.075), 0 0 8px rgba(102, 175, 233, 0.6);
  box-shadow: inset 0 1px 1px rgba(0,0,0,.075), 0 0 8px rgba(102, 175, 233, 0.6);
}
.form-control::-moz-placeholder {
  color: #999;
  opacity: 1;
}
.form-control:-ms-input-placeholder {
  color: #999;
}
.form-control::-webkit-input-placeholder {
  color: #999;
}
.form-control::-ms-expand {
  border: 0;
  background-color: transparent;
}
.form-control[disabled],
.form-control[readonly],
fieldset[disabled] .form-control {
  background-color: #eeeeee;
  opacity: 1;
}
.form-control[disabled],
fieldset[disabled] .form-control {
  cursor: not-allowed;
}
textarea.form-control {
  height: auto;
}
input[type="search"] {
  -webkit-appearance: none;
}
@media screen and (-webkit-min-device-pixel-ratio: 0) {
  input[type="date"].form-control,
  input[type="time"].form-control,
  input[type="datetime-local"].form-control,
  input[type="month"].form-control {
    line-height: 32px;
  }
  input[type="date"].input-sm,
  input[type="time"].input-sm,
  input[type="datetime-local"].input-sm,
  input[type="month"].input-sm,
  .input-group-sm input[type="date"],
  .input-group-sm input[type="time"],
  .input-group-sm input[type="datetime-local"],
  .input-group-sm input[type="month"] {
    line-height: 30px;
  }
  input[type="date"].input-lg,
  input[type="time"].input-lg,
  input[type="datetime-local"].input-lg,
  input[type="month"].input-lg,
  .input-group-lg input[type="date"],
  .input-group-lg input[type="time"],
  .input-group-lg input[type="datetime-local"],
  .input-group-lg input[type="month"] {
    line-height: 45px;
  }
}
.form-group {
  margin-bottom: 15px;
}
.radio,
.checkbox {
  position: relative;
  display: block;
  margin-top: 10px;
  margin-bottom: 10px;
}
.radio label,
.checkbox label {
  min-height: 18px;
  padding-left: 20px;
  margin-bottom: 0;
  font-weight: normal;
  cursor: pointer;
}
.radio input[type="radio"],
.radio-inline input[type="radio"],
.checkbox input[type="checkbox"],
.checkbox-inline input[type="checkbox"] {
  position: absolute;
  margin-left: -20px;
  margin-top: 4px \9;
}
.radio + .radio,
.checkbox + .checkbox {
  margin-top: -5px;
}
.radio-inline,
.checkbox-inline {
  position: relative;
  display: inline-block;
  padding-left: 20px;
  margin-bottom: 0;
  vertical-align: middle;
  font-weight: normal;
  cursor: pointer;
}
.radio-inline + .radio-inline,
.checkbox-inline + .checkbox-inline {
  margin-top: 0;
  margin-left: 10px;
}
input[type="radio"][disabled],
input[type="checkbox"][disabled],
input[type="radio"].disabled,
input[type="checkbox"].disabled,
fieldset[disabled] input[type="radio"],
fieldset[disabled] input[type="checkbox"] {
  cursor: not-allowed;
}
.radio-inline.disabled,
.checkbox-inline.disabled,
fieldset[disabled] .radio-inline,
fieldset[disabled] .checkbox-inline {
  cursor: not-allowed;
}
.radio.disabled label,
.checkbox.disabled label,
fieldset[disabled] .radio label,
fieldset[disabled] .checkbox label {
  cursor: not-allowed;
}
.form-control-static {
  padding-top: 7px;
  padding-bottom: 7px;
  margin-bottom: 0;
  min-height: 31px;
}
.form-control-static.input-lg,
.form-control-static.input-sm {
  padding-left: 0;
  padding-right: 0;
}
.input-sm {
  height: 30px;
  padding: 5px 10px;
  font-size: 12px;
  line-height: 1.5;
  border-radius: 1px;
}
select.input-sm {
  height: 30px;
  line-height: 30px;
}
textarea.input-sm,
select[multiple].input-sm {
  height: auto;
}
.form-group-sm .form-control {
  height: 30px;
  padding: 5px 10px;
  font-size: 12px;
  line-height: 1.5;
  border-radius: 1px;
}
.form-group-sm select.form-control {
  height: 30px;
  line-height: 30px;
}
.form-group-sm textarea.form-control,
.form-group-sm select[multiple].form-control {
  height: auto;
}
.form-group-sm .form-control-static {
  height: 30px;
  min-height: 30px;
  padding: 6px 10px;
  font-size: 12px;
  line-height: 1.5;
}
.input-lg {
  height: 45px;
  padding: 10px 16px;
  font-size: 17px;
  line-height: 1.3333333;
  border-radius: 3px;
}
select.input-lg {
  height: 45px;
  line-height: 45px;
}
textarea.input-lg,
select[multiple].input-lg {
  height: auto;
}
.form-group-lg .form-control {
  height: 45px;
  padding: 10px 16px;
  font-size: 17px;
  line-height: 1.3333333;
  border-radius: 3px;
}
.form-group-lg select.form-control {
  height: 45px;
  line-height: 45px;
}
.form-group-lg textarea.form-control,
.form-group-lg select[multiple].form-control {
  height: auto;
}
.form-group-lg .form-control-static {
  height: 45px;
  min-height: 35px;
  padding: 11px 16px;
  font-size: 17px;
  line-height: 1.3333333;
}
.has-feedback {
  position: relative;
}
.has-feedback .form-control {
  padding-right: 40px;
}
.form-control-feedback {
  position: absolute;
  top: 0;
  right: 0;
  z-index: 2;
  display: block;
  width: 32px;
  height: 32px;
  line-height: 32px;
  text-align: center;
  pointer-events: none;
}
.input-lg + .form-control-feedback,
.input-group-lg + .form-control-feedback,
.form-group-lg .form-control + .form-control-feedback {
  width: 45px;
  height: 45px;
  line-height: 45px;
}
.input-sm + .form-control-feedback,
.input-group-sm + .form-control-feedback,
.form-group-sm .form-control + .form-control-feedback {
  width: 30px;
  height: 30px;
  line-height: 30px;
}
.has-success .help-block,
.has-success .control-label,
.has-success .radio,
.has-success .checkbox,
.has-success .radio-inline,
.has-success .checkbox-inline,
.has-success.radio label,
.has-success.checkbox label,
.has-success.radio-inline label,
.has-success.checkbox-inline label {
  color: #3c763d;
}
.has-success .form-control {
  border-color: #3c763d;
  -webkit-box-shadow: inset 0 1px 1px rgba(0, 0, 0, 0.075);
  box-shadow: inset 0 1px 1px rgba(0, 0, 0, 0.075);
}
.has-success .form-control:focus {
  border-color: #2b542c;
  -webkit-box-shadow: inset 0 1px 1px rgba(0, 0, 0, 0.075), 0 0 6px #67b168;
  box-shadow: inset 0 1px 1px rgba(0, 0, 0, 0.075), 0 0 6px #67b168;
}
.has-success .input-group-addon {
  color: #3c763d;
  border-color: #3c763d;
  background-color: #dff0d8;
}
.has-success .form-control-feedback {
  color: #3c763d;
}
.has-warning .help-block,
.has-warning .control-label,
.has-warning .radio,
.has-warning .checkbox,
.has-warning .radio-inline,
.has-warning .checkbox-inline,
.has-warning.radio label,
.has-warning.checkbox label,
.has-warning.radio-inline label,
.has-warning.checkbox-inline label {
  color: #8a6d3b;
}
.has-warning .form-control {
  border-color: #8a6d3b;
  -webkit-box-shadow: inset 0 1px 1px rgba(0, 0, 0, 0.075);
  box-shadow: inset 0 1px 1px rgba(0, 0, 0, 0.075);
}
.has-warning .form-control:focus {
  border-color: #66512c;
  -webkit-box-shadow: inset 0 1px 1px rgba(0, 0, 0, 0.075), 0 0 6px #c0a16b;
  box-shadow: inset 0 1px 1px rgba(0, 0, 0, 0.075), 0 0 6px #c0a16b;
}
.has-warning .input-group-addon {
  color: #8a6d3b;
  border-color: #8a6d3b;
  background-color: #fcf8e3;
}
.has-warning .form-control-feedback {
  color: #8a6d3b;
}
.has-error .help-block,
.has-error .control-label,
.has-error .radio,
.has-error .checkbox,
.has-error .radio-inline,
.has-error .checkbox-inline,
.has-error.radio label,
.has-error.checkbox label,
.has-error.radio-inline label,
.has-error.checkbox-inline label {
  color: #a94442;
}
.has-error .form-control {
  border-color: #a94442;
  -webkit-box-shadow: inset 0 1px 1px rgba(0, 0, 0, 0.075);
  box-shadow: inset 0 1px 1px rgba(0, 0, 0, 0.075);
}
.has-error .form-control:focus {
  border-color: #843534;
  -webkit-box-shadow: inset 0 1px 1px rgba(0, 0, 0, 0.075), 0 0 6px #ce8483;
  box-shadow: inset 0 1px 1px rgba(0, 0, 0, 0.075), 0 0 6px #ce8483;
}
.has-error .input-group-addon {
  color: #a94442;
  border-color: #a94442;
  background-color: #f2dede;
}
.has-error .form-control-feedback {
  color: #a94442;
}
.has-feedback label ~ .form-control-feedback {
  top: 23px;
}
.has-feedback label.sr-only ~ .form-control-feedback {
  top: 0;
}
.help-block {
  display: block;
  margin-top: 5px;
  margin-bottom: 10px;
  color: #404040;
}
@media (min-width: 768px) {
  .form-inline .form-group {
    display: inline-block;
    margin-bottom: 0;
    vertical-align: middle;
  }
  .form-inline .form-control {
    display: inline-block;
    width: auto;
    vertical-align: middle;
  }
  .form-inline .form-control-static {
    display: inline-block;
  }
  .form-inline .input-group {
    display: inline-table;
    vertical-align: middle;
  }
  .form-inline .input-group .input-group-addon,
  .form-inline .input-group .input-group-btn,
  .form-inline .input-group .form-control {
    width: auto;
  }
  .form-inline .input-group > .form-control {
    width: 100%;
  }
  .form-inline .control-label {
    margin-bottom: 0;
    vertical-align: middle;
  }
  .form-inline .radio,
  .form-inline .checkbox {
    display: inline-block;
    margin-top: 0;
    margin-bottom: 0;
    vertical-align: middle;
  }
  .form-inline .radio label,
  .form-inline .checkbox label {
    padding-left: 0;
  }
  .form-inline .radio input[type="radio"],
  .form-inline .checkbox input[type="checkbox"] {
    position: relative;
    margin-left: 0;
  }
  .form-inline .has-feedback .form-control-feedback {
    top: 0;
  }
}
.form-horizontal .radio,
.form-horizontal .checkbox,
.form-horizontal .radio-inline,
.form-horizontal .checkbox-inline {
  margin-top: 0;
  margin-bottom: 0;
  padding-top: 7px;
}
.form-horizontal .radio,
.form-horizontal .checkbox {
  min-height: 25px;
}
.form-horizontal .form-group {
  margin-left: 0px;
  margin-right: 0px;
}
@media (min-width: 768px) {
  .form-horizontal .control-label {
    text-align: right;
    margin-bottom: 0;
    padding-top: 7px;
  }
}
.form-horizontal .has-feedback .form-control-feedback {
  right: 0px;
}
@media (min-width: 768px) {
  .form-horizontal .form-group-lg .control-label {
    padding-top: 11px;
    font-size: 17px;
  }
}
@media (min-width: 768px) {
  .form-horizontal .form-group-sm .control-label {
    padding-top: 6px;
    font-size: 12px;
  }
}
.btn {
  display: inline-block;
  margin-bottom: 0;
  font-weight: normal;
  text-align: center;
  vertical-align: middle;
  touch-action: manipulation;
  cursor: pointer;
  background-image: none;
  border: 1px solid transparent;
  white-space: nowrap;
  padding: 6px 12px;
  font-size: 13px;
  line-height: 1.42857143;
  border-radius: 2px;
  -webkit-user-select: none;
  -moz-user-select: none;
  -ms-user-select: none;
  user-select: none;
}
.btn:focus,
.btn:active:focus,
.btn.active:focus,
.btn.focus,
.btn:active.focus,
.btn.active.focus {
  outline: thin dotted;
  outline: 5px auto -webkit-focus-ring-color;
  outline-offset: -2px;
}
.btn:hover,
.btn:focus,
.btn.focus {
  color: #333;
  text-decoration: none;
}
.btn:active,
.btn.active {
  outline: 0;
  background-image: none;
  -webkit-box-shadow: inset 0 3px 5px rgba(0, 0, 0, 0.125);
  box-shadow: inset 0 3px 5px rgba(0, 0, 0, 0.125);
}
.btn.disabled,
.btn[disabled],
fieldset[disabled] .btn {
  cursor: not-allowed;
  opacity: 0.65;
  filter: alpha(opacity=65);
  -webkit-box-shadow: none;
  box-shadow: none;
}
a.btn.disabled,
fieldset[disabled] a.btn {
  pointer-events: none;
}
.btn-default {
  color: #333;
  background-color: #fff;
  border-color: #ccc;
}
.btn-default:focus,
.btn-default.focus {
  color: #333;
  background-color: #e6e6e6;
  border-color: #8c8c8c;
}
.btn-default:hover {
  color: #333;
  background-color: #e6e6e6;
  border-color: #adadad;
}
.btn-default:active,
.btn-default.active,
.open > .dropdown-toggle.btn-default {
  color: #333;
  background-color: #e6e6e6;
  border-color: #adadad;
}
.btn-default:active:hover,
.btn-default.active:hover,
.open > .dropdown-toggle.btn-default:hover,
.btn-default:active:focus,
.btn-default.active:focus,
.open > .dropdown-toggle.btn-default:focus,
.btn-default:active.focus,
.btn-default.active.focus,
.open > .dropdown-toggle.btn-default.focus {
  color: #333;
  background-color: #d4d4d4;
  border-color: #8c8c8c;
}
.btn-default:active,
.btn-default.active,
.open > .dropdown-toggle.btn-default {
  background-image: none;
}
.btn-default.disabled:hover,
.btn-default[disabled]:hover,
fieldset[disabled] .btn-default:hover,
.btn-default.disabled:focus,
.btn-default[disabled]:focus,
fieldset[disabled] .btn-default:focus,
.btn-default.disabled.focus,
.btn-default[disabled].focus,
fieldset[disabled] .btn-default.focus {
  background-color: #fff;
  border-color: #ccc;
}
.btn-default .badge {
  color: #fff;
  background-color: #333;
}
.btn-primary {
  color: #fff;
  background-color: #337ab7;
  border-color: #2e6da4;
}
.btn-primary:focus,
.btn-primary.focus {
  color: #fff;
  background-color: #286090;
  border-color: #122b40;
}
.btn-primary:hover {
  color: #fff;
  background-color: #286090;
  border-color: #204d74;
}
.btn-primary:active,
.btn-primary.active,
.open > .dropdown-toggle.btn-primary {
  color: #fff;
  background-color: #286090;
  border-color: #204d74;
}
.btn-primary:active:hover,
.btn-primary.active:hover,
.open > .dropdown-toggle.btn-primary:hover,
.btn-primary:active:focus,
.btn-primary.active:focus,
.open > .dropdown-toggle.btn-primary:focus,
.btn-primary:active.focus,
.btn-primary.active.focus,
.open > .dropdown-toggle.btn-primary.focus {
  color: #fff;
  background-color: #204d74;
  border-color: #122b40;
}
.btn-primary:active,
.btn-primary.active,
.open > .dropdown-toggle.btn-primary {
  background-image: none;
}
.btn-primary.disabled:hover,
.btn-primary[disabled]:hover,
fieldset[disabled] .btn-primary:hover,
.btn-primary.disabled:focus,
.btn-primary[disabled]:focus,
fieldset[disabled] .btn-primary:focus,
.btn-primary.disabled.focus,
.btn-primary[disabled].focus,
fieldset[disabled] .btn-primary.focus {
  background-color: #337ab7;
  border-color: #2e6da4;
}
.btn-primary .badge {
  color: #337ab7;
  background-color: #fff;
}
.btn-success {
  color: #fff;
  background-color: #5cb85c;
  border-color: #4cae4c;
}
.btn-success:focus,
.btn-success.focus {
  color: #fff;
  background-color: #449d44;
  border-color: #255625;
}
.btn-success:hover {
  color: #fff;
  background-color: #449d44;
  border-color: #398439;
}
.btn-success:active,
.btn-success.active,
.open > .dropdown-toggle.btn-success {
  color: #fff;
  background-color: #449d44;
  border-color: #398439;
}
.btn-success:active:hover,
.btn-success.active:hover,
.open > .dropdown-toggle.btn-success:hover,
.btn-success:active:focus,
.btn-success.active:focus,
.open > .dropdown-toggle.btn-success:focus,
.btn-success:active.focus,
.btn-success.active.focus,
.open > .dropdown-toggle.btn-success.focus {
  color: #fff;
  background-color: #398439;
  border-color: #255625;
}
.btn-success:active,
.btn-success.active,
.open > .dropdown-toggle.btn-success {
  background-image: none;
}
.btn-success.disabled:hover,
.btn-success[disabled]:hover,
fieldset[disabled] .btn-success:hover,
.btn-success.disabled:focus,
.btn-success[disabled]:focus,
fieldset[disabled] .btn-success:focus,
.btn-success.disabled.focus,
.btn-success[disabled].focus,
fieldset[disabled] .btn-success.focus {
  background-color: #5cb85c;
  border-color: #4cae4c;
}
.btn-success .badge {
  color: #5cb85c;
  background-color: #fff;
}
.btn-info {
  color: #fff;
  background-color: #5bc0de;
  border-color: #46b8da;
}
.btn-info:focus,
.btn-info.focus {
  color: #fff;
  background-color: #31b0d5;
  border-color: #1b6d85;
}
.btn-info:hover {
  color: #fff;
  background-color: #31b0d5;
  border-color: #269abc;
}
.btn-info:active,
.btn-info.active,
.open > .dropdown-toggle.btn-info {
  color: #fff;
  background-color: #31b0d5;
  border-color: #269abc;
}
.btn-info:active:hover,
.btn-info.active:hover,
.open > .dropdown-toggle.btn-info:hover,
.btn-info:active:focus,
.btn-info.active:focus,
.open > .dropdown-toggle.btn-info:focus,
.btn-info:active.focus,
.btn-info.active.focus,
.open > .dropdown-toggle.btn-info.focus {
  color: #fff;
  background-color: #269abc;
  border-color: #1b6d85;
}
.btn-info:active,
.btn-info.active,
.open > .dropdown-toggle.btn-info {
  background-image: none;
}
.btn-info.disabled:hover,
.btn-info[disabled]:hover,
fieldset[disabled] .btn-info:hover,
.btn-info.disabled:focus,
.btn-info[disabled]:focus,
fieldset[disabled] .btn-info:focus,
.btn-info.disabled.focus,
.btn-info[disabled].focus,
fieldset[disabled] .btn-info.focus {
  background-color: #5bc0de;
  border-color: #46b8da;
}
.btn-info .badge {
  color: #5bc0de;
  background-color: #fff;
}
.btn-warning {
  color: #fff;
  background-color: #f0ad4e;
  border-color: #eea236;
}
.btn-warning:focus,
.btn-warning.focus {
  color: #fff;
  background-color: #ec971f;
  border-color: #985f0d;
}
.btn-warning:hover {
  color: #fff;
  background-color: #ec971f;
  border-color: #d58512;
}
.btn-warning:active,
.btn-warning.active,
.open > .dropdown-toggle.btn-warning {
  color: #fff;
  background-color: #ec971f;
  border-color: #d58512;
}
.btn-warning:active:hover,
.btn-warning.active:hover,
.open > .dropdown-toggle.btn-warning:hover,
.btn-warning:active:focus,
.btn-warning.active:focus,
.open > .dropdown-toggle.btn-warning:focus,
.btn-warning:active.focus,
.btn-warning.active.focus,
.open > .dropdown-toggle.btn-warning.focus {
  color: #fff;
  background-color: #d58512;
  border-color: #985f0d;
}
.btn-warning:active,
.btn-warning.active,
.open > .dropdown-toggle.btn-warning {
  background-image: none;
}
.btn-warning.disabled:hover,
.btn-warning[disabled]:hover,
fieldset[disabled] .btn-warning:hover,
.btn-warning.disabled:focus,
.btn-warning[disabled]:focus,
fieldset[disabled] .btn-warning:focus,
.btn-warning.disabled.focus,
.btn-warning[disabled].focus,
fieldset[disabled] .btn-warning.focus {
  background-color: #f0ad4e;
  border-color: #eea236;
}
.btn-warning .badge {
  color: #f0ad4e;
  background-color: #fff;
}
.btn-danger {
  color: #fff;
  background-color: #d9534f;
  border-color: #d43f3a;
}
.btn-danger:focus,
.btn-danger.focus {
  color: #fff;
  background-color: #c9302c;
  border-color: #761c19;
}
.btn-danger:hover {
  color: #fff;
  background-color: #c9302c;
  border-color: #ac2925;
}
.btn-danger:active,
.btn-danger.active,
.open > .dropdown-toggle.btn-danger {
  color: #fff;
  background-color: #c9302c;
  border-color: #ac2925;
}
.btn-danger:active:hover,
.btn-danger.active:hover,
.open > .dropdown-toggle.btn-danger:hover,
.btn-danger:active:focus,
.btn-danger.active:focus,
.open > .dropdown-toggle.btn-danger:focus,
.btn-danger:active.focus,
.btn-danger.active.focus,
.open > .dropdown-toggle.btn-danger.focus {
  color: #fff;
  background-color: #ac2925;
  border-color: #761c19;
}
.btn-danger:active,
.btn-danger.active,
.open > .dropdown-toggle.btn-danger {
  background-image: none;
}
.btn-danger.disabled:hover,
.btn-danger[disabled]:hover,
fieldset[disabled] .btn-danger:hover,
.btn-danger.disabled:focus,
.btn-danger[disabled]:focus,
fieldset[disabled] .btn-danger:focus,
.btn-danger.disabled.focus,
.btn-danger[disabled].focus,
fieldset[disabled] .btn-danger.focus {
  background-color: #d9534f;
  border-color: #d43f3a;
}
.btn-danger .badge {
  color: #d9534f;
  background-color: #fff;
}
.btn-link {
  color: #337ab7;
  font-weight: normal;
  border-radius: 0;
}
.btn-link,
.btn-link:active,
.btn-link.active,
.btn-link[disabled],
fieldset[disabled] .btn-link {
  background-color: transparent;
  -webkit-box-shadow: none;
  box-shadow: none;
}
.btn-link,
.btn-link:hover,
.btn-link:focus,
.btn-link:active {
  border-color: transparent;
}
.btn-link:hover,
.btn-link:focus {
  color: #23527c;
  text-decoration: underline;
  background-color: transparent;
}
.btn-link[disabled]:hover,
fieldset[disabled] .btn-link:hover,
.btn-link[disabled]:focus,
fieldset[disabled] .btn-link:focus {
  color: #777777;
  text-decoration: none;
}
.btn-lg,
.btn-group-lg > .btn {
  padding: 10px 16px;
  font-size: 17px;
  line-height: 1.3333333;
  border-radius: 3px;
}
.btn-sm,
.btn-group-sm > .btn {
  padding: 5px 10px;
  font-size: 12px;
  line-height: 1.5;
  border-radius: 1px;
}
.btn-xs,
.btn-group-xs > .btn {
  padding: 1px 5px;
  font-size: 12px;
  line-height: 1.5;
  border-radius: 1px;
}
.btn-block {
  display: block;
  width: 100%;
}
.btn-block + .btn-block {
  margin-top: 5px;
}
input[type="submit"].btn-block,
input[type="reset"].btn-block,
input[type="button"].btn-block {
  width: 100%;
}
.fade {
  opacity: 0;
  -webkit-transition: opacity 0.15s linear;
  -o-transition: opacity 0.15s linear;
  transition: opacity 0.15s linear;
}
.fade.in {
  opacity: 1;
}
.collapse {
  display: none;
}
.collapse.in {
  display: block;
}
tr.collapse.in {
  display: table-row;
}
tbody.collapse.in {
  display: table-row-group;
}
.collapsing {
  position: relative;
  height: 0;
  overflow: hidden;
  -webkit-transition-property: height, visibility;
  transition-property: height, visibility;
  -webkit-transition-duration: 0.35s;
  transition-duration: 0.35s;
  -webkit-transition-timing-function: ease;
  transition-timing-function: ease;
}
.caret {
  display: inline-block;
  width: 0;
  height: 0;
  margin-left: 2px;
  vertical-align: middle;
  border-top: 4px dashed;
  border-top: 4px solid \9;
  border-right: 4px solid transparent;
  border-left: 4px solid transparent;
}
.dropup,
.dropdown {
  position: relative;
}
.dropdown-toggle:focus {
  outline: 0;
}
.dropdown-menu {
  position: absolute;
  top: 100%;
  left: 0;
  z-index: 1000;
  display: none;
  float: left;
  min-width: 160px;
  padding: 5px 0;
  margin: 2px 0 0;
  list-style: none;
  font-size: 13px;
  text-align: left;
  background-color: #fff;
  border: 1px solid #ccc;
  border: 1px solid rgba(0, 0, 0, 0.15);
  border-radius: 2px;
  -webkit-box-shadow: 0 6px 12px rgba(0, 0, 0, 0.175);
  box-shadow: 0 6px 12px rgba(0, 0, 0, 0.175);
  background-clip: padding-box;
}
.dropdown-menu.pull-right {
  right: 0;
  left: auto;
}
.dropdown-menu .divider {
  height: 1px;
  margin: 8px 0;
  overflow: hidden;
  background-color: #e5e5e5;
}
.dropdown-menu > li > a {
  display: block;
  padding: 3px 20px;
  clear: both;
  font-weight: normal;
  line-height: 1.42857143;
  color: #333333;
  white-space: nowrap;
}
.dropdown-menu > li > a:hover,
.dropdown-menu > li > a:focus {
  text-decoration: none;
  color: #262626;
  background-color: #f5f5f5;
}
.dropdown-menu > .active > a,
.dropdown-menu > .active > a:hover,
.dropdown-menu > .active > a:focus {
  color: #fff;
  text-decoration: none;
  outline: 0;
  background-color: #337ab7;
}
.dropdown-menu > .disabled > a,
.dropdown-menu > .disabled > a:hover,
.dropdown-menu > .disabled > a:focus {
  color: #777777;
}
.dropdown-menu > .disabled > a:hover,
.dropdown-menu > .disabled > a:focus {
  text-decoration: none;
  background-color: transparent;
  background-image: none;
  filter: progid:DXImageTransform.Microsoft.gradient(enabled = false);
  cursor: not-allowed;
}
.open > .dropdown-menu {
  display: block;
}
.open > a {
  outline: 0;
}
.dropdown-menu-right {
  left: auto;
  right: 0;
}
.dropdown-menu-left {
  left: 0;
  right: auto;
}
.dropdown-header {
  display: block;
  padding: 3px 20px;
  font-size: 12px;
  line-height: 1.42857143;
  color: #777777;
  white-space: nowrap;
}
.dropdown-backdrop {
  position: fixed;
  left: 0;
  right: 0;
  bottom: 0;
  top: 0;
  z-index: 990;
}
.pull-right > .dropdown-menu {
  right: 0;
  left: auto;
}
.dropup .caret,
.navbar-fixed-bottom .dropdown .caret {
  border-top: 0;
  border-bottom: 4px dashed;
  border-bottom: 4px solid \9;
  content: "";
}
.dropup .dropdown-menu,
.navbar-fixed-bottom .dropdown .dropdown-menu {
  top: auto;
  bottom: 100%;
  margin-bottom: 2px;
}
@media (min-width: 541px) {
  .navbar-right .dropdown-menu {
    left: auto;
    right: 0;
  }
  .navbar-right .dropdown-menu-left {
    left: 0;
    right: auto;
  }
}
.btn-group,
.btn-group-vertical {
  position: relative;
  display: inline-block;
  vertical-align: middle;
}
.btn-group > .btn,
.btn-group-vertical > .btn {
  position: relative;
  float: left;
}
.btn-group > .btn:hover,
.btn-group-vertical > .btn:hover,
.btn-group > .btn:focus,
.btn-group-vertical > .btn:focus,
.btn-group > .btn:active,
.btn-group-vertical > .btn:active,
.btn-group > .btn.active,
.btn-group-vertical > .btn.active {
  z-index: 2;
}
.btn-group .btn + .btn,
.btn-group .btn + .btn-group,
.btn-group .btn-group + .btn,
.btn-group .btn-group + .btn-group {
  margin-left: -1px;
}
.btn-toolbar {
  margin-left: -5px;
}
.btn-toolbar .btn,
.btn-toolbar .btn-group,
.btn-toolbar .input-group {
  float: left;
}
.btn-toolbar > .btn,
.btn-toolbar > .btn-group,
.btn-toolbar > .input-group {
  margin-left: 5px;
}
.btn-group > .btn:not(:first-child):not(:last-child):not(.dropdown-toggle) {
  border-radius: 0;
}
.btn-group > .btn:first-child {
  margin-left: 0;
}
.btn-group > .btn:first-child:not(:last-child):not(.dropdown-toggle) {
  border-bottom-right-radius: 0;
  border-top-right-radius: 0;
}
.btn-group > .btn:last-child:not(:first-child),
.btn-group > .dropdown-toggle:not(:first-child) {
  border-bottom-left-radius: 0;
  border-top-left-radius: 0;
}
.btn-group > .btn-group {
  float: left;
}
.btn-group > .btn-group:not(:first-child):not(:last-child) > .btn {
  border-radius: 0;
}
.btn-group > .btn-group:first-child:not(:last-child) > .btn:last-child,
.btn-group > .btn-group:first-child:not(:last-child) > .dropdown-toggle {
  border-bottom-right-radius: 0;
  border-top-right-radius: 0;
}
.btn-group > .btn-group:last-child:not(:first-child) > .btn:first-child {
  border-bottom-left-radius: 0;
  border-top-left-radius: 0;
}
.btn-group .dropdown-toggle:active,
.btn-group.open .dropdown-toggle {
  outline: 0;
}
.btn-group > .btn + .dropdown-toggle {
  padding-left: 8px;
  padding-right: 8px;
}
.btn-group > .btn-lg + .dropdown-toggle {
  padding-left: 12px;
  padding-right: 12px;
}
.btn-group.open .dropdown-toggle {
  -webkit-box-shadow: inset 0 3px 5px rgba(0, 0, 0, 0.125);
  box-shadow: inset 0 3px 5px rgba(0, 0, 0, 0.125);
}
.btn-group.open .dropdown-toggle.btn-link {
  -webkit-box-shadow: none;
  box-shadow: none;
}
.btn .caret {
  margin-left: 0;
}
.btn-lg .caret {
  border-width: 5px 5px 0;
  border-bottom-width: 0;
}
.dropup .btn-lg .caret {
  border-width: 0 5px 5px;
}
.btn-group-vertical > .btn,
.btn-group-vertical > .btn-group,
.btn-group-vertical > .btn-group > .btn {
  display: block;
  float: none;
  width: 100%;
  max-width: 100%;
}
.btn-group-vertical > .btn-group > .btn {
  float: none;
}
.btn-group-vertical > .btn + .btn,
.btn-group-vertical > .btn + .btn-group,
.btn-group-vertical > .btn-group + .btn,
.btn-group-vertical > .btn-group + .btn-group {
  margin-top: -1px;
  margin-left: 0;
}
.btn-group-vertical > .btn:not(:first-child):not(:last-child) {
  border-radius: 0;
}
.btn-group-vertical > .btn:first-child:not(:last-child) {
  border-top-right-radius: 2px;
  border-top-left-radius: 2px;
  border-bottom-right-radius: 0;
  border-bottom-left-radius: 0;
}
.btn-group-vertical > .btn:last-child:not(:first-child) {
  border-top-right-radius: 0;
  border-top-left-radius: 0;
  border-bottom-right-radius: 2px;
  border-bottom-left-radius: 2px;
}
.btn-group-vertical > .btn-group:not(:first-child):not(:last-child) > .btn {
  border-radius: 0;
}
.btn-group-vertical > .btn-group:first-child:not(:last-child) > .btn:last-child,
.btn-group-vertical > .btn-group:first-child:not(:last-child) > .dropdown-toggle {
  border-bottom-right-radius: 0;
  border-bottom-left-radius: 0;
}
.btn-group-vertical > .btn-group:last-child:not(:first-child) > .btn:first-child {
  border-top-right-radius: 0;
  border-top-left-radius: 0;
}
.btn-group-justified {
  display: table;
  width: 100%;
  table-layout: fixed;
  border-collapse: separate;
}
.btn-group-justified > .btn,
.btn-group-justified > .btn-group {
  float: none;
  display: table-cell;
  width: 1%;
}
.btn-group-justified > .btn-group .btn {
  width: 100%;
}
.btn-group-justified > .btn-group .dropdown-menu {
  left: auto;
}
[data-toggle="buttons"] > .btn input[type="radio"],
[data-toggle="buttons"] > .btn-group > .btn input[type="radio"],
[data-toggle="buttons"] > .btn input[type="checkbox"],
[data-toggle="buttons"] > .btn-group > .btn input[type="checkbox"] {
  position: absolute;
  clip: rect(0, 0, 0, 0);
  pointer-events: none;
}
.input-group {
  position: relative;
  display: table;
  border-collapse: separate;
}
.input-group[class*="col-"] {
  float: none;
  padding-left: 0;
  padding-right: 0;
}
.input-group .form-control {
  position: relative;
  z-index: 2;
  float: left;
  width: 100%;
  margin-bottom: 0;
}
.input-group .form-control:focus {
  z-index: 3;
}
.input-group-lg > .form-control,
.input-group-lg > .input-group-addon,
.input-group-lg > .input-group-btn > .btn {
  height: 45px;
  padding: 10px 16px;
  font-size: 17px;
  line-height: 1.3333333;
  border-radius: 3px;
}
select.input-group-lg > .form-control,
select.input-group-lg > .input-group-addon,
select.input-group-lg > .input-group-btn > .btn {
  height: 45px;
  line-height: 45px;
}
textarea.input-group-lg > .form-control,
textarea.input-group-lg > .input-group-addon,
textarea.input-group-lg > .input-group-btn > .btn,
select[multiple].input-group-lg > .form-control,
select[multiple].input-group-lg > .input-group-addon,
select[multiple].input-group-lg > .input-group-btn > .btn {
  height: auto;
}
.input-group-sm > .form-control,
.input-group-sm > .input-group-addon,
.input-group-sm > .input-group-btn > .btn {
  height: 30px;
  padding: 5px 10px;
  font-size: 12px;
  line-height: 1.5;
  border-radius: 1px;
}
select.input-group-sm > .form-control,
select.input-group-sm > .input-group-addon,
select.input-group-sm > .input-group-btn > .btn {
  height: 30px;
  line-height: 30px;
}
textarea.input-group-sm > .form-control,
textarea.input-group-sm > .input-group-addon,
textarea.input-group-sm > .input-group-btn > .btn,
select[multiple].input-group-sm > .form-control,
select[multiple].input-group-sm > .input-group-addon,
select[multiple].input-group-sm > .input-group-btn > .btn {
  height: auto;
}
.input-group-addon,
.input-group-btn,
.input-group .form-control {
  display: table-cell;
}
.input-group-addon:not(:first-child):not(:last-child),
.input-group-btn:not(:first-child):not(:last-child),
.input-group .form-control:not(:first-child):not(:last-child) {
  border-radius: 0;
}
.input-group-addon,
.input-group-btn {
  width: 1%;
  white-space: nowrap;
  vertical-align: middle;
}
.input-group-addon {
  padding: 6px 12px;
  font-size: 13px;
  font-weight: normal;
  line-height: 1;
  color: #555555;
  text-align: center;
  background-color: #eeeeee;
  border: 1px solid #ccc;
  border-radius: 2px;
}
.input-group-addon.input-sm {
  padding: 5px 10px;
  font-size: 12px;
  border-radius: 1px;
}
.input-group-addon.input-lg {
  padding: 10px 16px;
  font-size: 17px;
  border-radius: 3px;
}
.input-group-addon input[type="radio"],
.input-group-addon input[type="checkbox"] {
  margin-top: 0;
}
.input-group .form-control:first-child,
.input-group-addon:first-child,
.input-group-btn:first-child > .btn,
.input-group-btn:first-child > .btn-group > .btn,
.input-group-btn:first-child > .dropdown-toggle,
.input-group-btn:last-child > .btn:not(:last-child):not(.dropdown-toggle),
.input-group-btn:last-child > .btn-group:not(:last-child) > .btn {
  border-bottom-right-radius: 0;
  border-top-right-radius: 0;
}
.input-group-addon:first-child {
  border-right: 0;
}
.input-group .form-control:last-child,
.input-group-addon:last-child,
.input-group-btn:last-child > .btn,
.input-group-btn:last-child > .btn-group > .btn,
.input-group-btn:last-child > .dropdown-toggle,
.input-group-btn:first-child > .btn:not(:first-child),
.input-group-btn:first-child > .btn-group:not(:first-child) > .btn {
  border-bottom-left-radius: 0;
  border-top-left-radius: 0;
}
.input-group-addon:last-child {
  border-left: 0;
}
.input-group-btn {
  position: relative;
  font-size: 0;
  white-space: nowrap;
}
.input-group-btn > .btn {
  position: relative;
}
.input-group-btn > .btn + .btn {
  margin-left: -1px;
}
.input-group-btn > .btn:hover,
.input-group-btn > .btn:focus,
.input-group-btn > .btn:active {
  z-index: 2;
}
.input-group-btn:first-child > .btn,
.input-group-btn:first-child > .btn-group {
  margin-right: -1px;
}
.input-group-btn:last-child > .btn,
.input-group-btn:last-child > .btn-group {
  z-index: 2;
  margin-left: -1px;
}
.nav {
  margin-bottom: 0;
  padding-left: 0;
  list-style: none;
}
.nav > li {
  position: relative;
  display: block;
}
.nav > li > a {
  position: relative;
  display: block;
  padding: 10px 15px;
}
.nav > li > a:hover,
.nav > li > a:focus {
  text-decoration: none;
  background-color: #eeeeee;
}
.nav > li.disabled > a {
  color: #777777;
}
.nav > li.disabled > a:hover,
.nav > li.disabled > a:focus {
  color: #777777;
  text-decoration: none;
  background-color: transparent;
  cursor: not-allowed;
}
.nav .open > a,
.nav .open > a:hover,
.nav .open > a:focus {
  background-color: #eeeeee;
  border-color: #337ab7;
}
.nav .nav-divider {
  height: 1px;
  margin: 8px 0;
  overflow: hidden;
  background-color: #e5e5e5;
}
.nav > li > a > img {
  max-width: none;
}
.nav-tabs {
  border-bottom: 1px solid #ddd;
}
.nav-tabs > li {
  float: left;
  margin-bottom: -1px;
}
.nav-tabs > li > a {
  margin-right: 2px;
  line-height: 1.42857143;
  border: 1px solid transparent;
  border-radius: 2px 2px 0 0;
}
.nav-tabs > li > a:hover {
  border-color: #eeeeee #eeeeee #ddd;
}
.nav-tabs > li.active > a,
.nav-tabs > li.active > a:hover,
.nav-tabs > li.active > a:focus {
  color: #555555;
  background-color: #fff;
  border: 1px solid #ddd;
  border-bottom-color: transparent;
  cursor: default;
}
.nav-tabs.nav-justified {
  width: 100%;
  border-bottom: 0;
}
.nav-tabs.nav-justified > li {
  float: none;
}
.nav-tabs.nav-justified > li > a {
  text-align: center;
  margin-bottom: 5px;
}
.nav-tabs.nav-justified > .dropdown .dropdown-menu {
  top: auto;
  left: auto;
}
@media (min-width: 768px) {
  .nav-tabs.nav-justified > li {
    display: table-cell;
    width: 1%;
  }
  .nav-tabs.nav-justified > li > a {
    margin-bottom: 0;
  }
}
.nav-tabs.nav-justified > li > a {
  margin-right: 0;
  border-radius: 2px;
}
.nav-tabs.nav-justified > .active > a,
.nav-tabs.nav-justified > .active > a:hover,
.nav-tabs.nav-justified > .active > a:focus {
  border: 1px solid #ddd;
}
@media (min-width: 768px) {
  .nav-tabs.nav-justified > li > a {
    border-bottom: 1px solid #ddd;
    border-radius: 2px 2px 0 0;
  }
  .nav-tabs.nav-justified > .active > a,
  .nav-tabs.nav-justified > .active > a:hover,
  .nav-tabs.nav-justified > .active > a:focus {
    border-bottom-color: #fff;
  }
}
.nav-pills > li {
  float: left;
}
.nav-pills > li > a {
  border-radius: 2px;
}
.nav-pills > li + li {
  margin-left: 2px;
}
.nav-pills > li.active > a,
.nav-pills > li.active > a:hover,
.nav-pills > li.active > a:focus {
  color: #fff;
  background-color: #337ab7;
}
.nav-stacked > li {
  float: none;
}
.nav-stacked > li + li {
  margin-top: 2px;
  margin-left: 0;
}
.nav-justified {
  width: 100%;
}
.nav-justified > li {
  float: none;
}
.nav-justified > li > a {
  text-align: center;
  margin-bottom: 5px;
}
.nav-justified > .dropdown .dropdown-menu {
  top: auto;
  left: auto;
}
@media (min-width: 768px) {
  .nav-justified > li {
    display: table-cell;
    width: 1%;
  }
  .nav-justified > li > a {
    margin-bottom: 0;
  }
}
.nav-tabs-justified {
  border-bottom: 0;
}
.nav-tabs-justified > li > a {
  margin-right: 0;
  border-radius: 2px;
}
.nav-tabs-justified > .active > a,
.nav-tabs-justified > .active > a:hover,
.nav-tabs-justified > .active > a:focus {
  border: 1px solid #ddd;
}
@media (min-width: 768px) {
  .nav-tabs-justified > li > a {
    border-bottom: 1px solid #ddd;
    border-radius: 2px 2px 0 0;
  }
  .nav-tabs-justified > .active > a,
  .nav-tabs-justified > .active > a:hover,
  .nav-tabs-justified > .active > a:focus {
    border-bottom-color: #fff;
  }
}
.tab-content > .tab-pane {
  display: none;
}
.tab-content > .active {
  display: block;
}
.nav-tabs .dropdown-menu {
  margin-top: -1px;
  border-top-right-radius: 0;
  border-top-left-radius: 0;
}
.navbar {
  position: relative;
  min-height: 30px;
  margin-bottom: 18px;
  border: 1px solid transparent;
}
@media (min-width: 541px) {
  .navbar {
    border-radius: 2px;
  }
}
@media (min-width: 541px) {
  .navbar-header {
    float: left;
  }
}
.navbar-collapse {
  overflow-x: visible;
  padding-right: 0px;
  padding-left: 0px;
  border-top: 1px solid transparent;
  box-shadow: inset 0 1px 0 rgba(255, 255, 255, 0.1);
  -webkit-overflow-scrolling: touch;
}
.navbar-collapse.in {
  overflow-y: auto;
}
@media (min-width: 541px) {
  .navbar-collapse {
    width: auto;
    border-top: 0;
    box-shadow: none;
  }
  .navbar-collapse.collapse {
    display: block !important;
    height: auto !important;
    padding-bottom: 0;
    overflow: visible !important;
  }
  .navbar-collapse.in {
    overflow-y: visible;
  }
  .navbar-fixed-top .navbar-collapse,
  .navbar-static-top .navbar-collapse,
  .navbar-fixed-bottom .navbar-collapse {
    padding-left: 0;
    padding-right: 0;
  }
}
.navbar-fixed-top .navbar-collapse,
.navbar-fixed-bottom .navbar-collapse {
  max-height: 340px;
}
@media (max-device-width: 540px) and (orientation: landscape) {
  .navbar-fixed-top .navbar-collapse,
  .navbar-fixed-bottom .navbar-collapse {
    max-height: 200px;
  }
}
.container > .navbar-header,
.container-fluid > .navbar-header,
.container > .navbar-collapse,
.container-fluid > .navbar-collapse {
  margin-right: 0px;
  margin-left: 0px;
}
@media (min-width: 541px) {
  .container > .navbar-header,
  .container-fluid > .navbar-header,
  .container > .navbar-collapse,
  .container-fluid > .navbar-collapse {
    margin-right: 0;
    margin-left: 0;
  }
}
.navbar-static-top {
  z-index: 1000;
  border-width: 0 0 1px;
}
@media (min-width: 541px) {
  .navbar-static-top {
    border-radius: 0;
  }
}
.navbar-fixed-top,
.navbar-fixed-bottom {
  position: fixed;
  right: 0;
  left: 0;
  z-index: 1030;
}
@media (min-width: 541px) {
  .navbar-fixed-top,
  .navbar-fixed-bottom {
    border-radius: 0;
  }
}
.navbar-fixed-top {
  top: 0;
  border-width: 0 0 1px;
}
.navbar-fixed-bottom {
  bottom: 0;
  margin-bottom: 0;
  border-width: 1px 0 0;
}
.navbar-brand {
  float: left;
  padding: 6px 0px;
  font-size: 17px;
  line-height: 18px;
  height: 30px;
}
.navbar-brand:hover,
.navbar-brand:focus {
  text-decoration: none;
}
.navbar-brand > img {
  display: block;
}
@media (min-width: 541px) {
  .navbar > .container .navbar-brand,
  .navbar > .container-fluid .navbar-brand {
    margin-left: 0px;
  }
}
.navbar-toggle {
  position: relative;
  float: right;
  margin-right: 0px;
  padding: 9px 10px;
  margin-top: -2px;
  margin-bottom: -2px;
  background-color: transparent;
  background-image: none;
  border: 1px solid transparent;
  border-radius: 2px;
}
.navbar-toggle:focus {
  outline: 0;
}
.navbar-toggle .icon-bar {
  display: block;
  width: 22px;
  height: 2px;
  border-radius: 1px;
}
.navbar-toggle .icon-bar + .icon-bar {
  margin-top: 4px;
}
@media (min-width: 541px) {
  .navbar-toggle {
    display: none;
  }
}
.navbar-nav {
  margin: 3px 0px;
}
.navbar-nav > li > a {
  padding-top: 10px;
  padding-bottom: 10px;
  line-height: 18px;
}
@media (max-width: 540px) {
  .navbar-nav .open .dropdown-menu {
    position: static;
    float: none;
    width: auto;
    margin-top: 0;
    background-color: transparent;
    border: 0;
    box-shadow: none;
  }
  .navbar-nav .open .dropdown-menu > li > a,
  .navbar-nav .open .dropdown-menu .dropdown-header {
    padding: 5px 15px 5px 25px;
  }
  .navbar-nav .open .dropdown-menu > li > a {
    line-height: 18px;
  }
  .navbar-nav .open .dropdown-menu > li > a:hover,
  .navbar-nav .open .dropdown-menu > li > a:focus {
    background-image: none;
  }
}
@media (min-width: 541px) {
  .navbar-nav {
    float: left;
    margin: 0;
  }
  .navbar-nav > li {
    float: left;
  }
  .navbar-nav > li > a {
    padding-top: 6px;
    padding-bottom: 6px;
  }
}
.navbar-form {
  margin-left: 0px;
  margin-right: 0px;
  padding: 10px 0px;
  border-top: 1px solid transparent;
  border-bottom: 1px solid transparent;
  -webkit-box-shadow: inset 0 1px 0 rgba(255, 255, 255, 0.1), 0 1px 0 rgba(255, 255, 255, 0.1);
  box-shadow: inset 0 1px 0 rgba(255, 255, 255, 0.1), 0 1px 0 rgba(255, 255, 255, 0.1);
  margin-top: -1px;
  margin-bottom: -1px;
}
@media (min-width: 768px) {
  .navbar-form .form-group {
    display: inline-block;
    margin-bottom: 0;
    vertical-align: middle;
  }
  .navbar-form .form-control {
    display: inline-block;
    width: auto;
    vertical-align: middle;
  }
  .navbar-form .form-control-static {
    display: inline-block;
  }
  .navbar-form .input-group {
    display: inline-table;
    vertical-align: middle;
  }
  .navbar-form .input-group .input-group-addon,
  .navbar-form .input-group .input-group-btn,
  .navbar-form .input-group .form-control {
    width: auto;
  }
  .navbar-form .input-group > .form-control {
    width: 100%;
  }
  .navbar-form .control-label {
    margin-bottom: 0;
    vertical-align: middle;
  }
  .navbar-form .radio,
  .navbar-form .checkbox {
    display: inline-block;
    margin-top: 0;
    margin-bottom: 0;
    vertical-align: middle;
  }
  .navbar-form .radio label,
  .navbar-form .checkbox label {
    padding-left: 0;
  }
  .navbar-form .radio input[type="radio"],
  .navbar-form .checkbox input[type="checkbox"] {
    position: relative;
    margin-left: 0;
  }
  .navbar-form .has-feedback .form-control-feedback {
    top: 0;
  }
}
@media (max-width: 540px) {
  .navbar-form .form-group {
    margin-bottom: 5px;
  }
  .navbar-form .form-group:last-child {
    margin-bottom: 0;
  }
}
@media (min-width: 541px) {
  .navbar-form {
    width: auto;
    border: 0;
    margin-left: 0;
    margin-right: 0;
    padding-top: 0;
    padding-bottom: 0;
    -webkit-box-shadow: none;
    box-shadow: none;
  }
}
.navbar-nav > li > .dropdown-menu {
  margin-top: 0;
  border-top-right-radius: 0;
  border-top-left-radius: 0;
}
.navbar-fixed-bottom .navbar-nav > li > .dropdown-menu {
  margin-bottom: 0;
  border-top-right-radius: 2px;
  border-top-left-radius: 2px;
  border-bottom-right-radius: 0;
  border-bottom-left-radius: 0;
}
.navbar-btn {
  margin-top: -1px;
  margin-bottom: -1px;
}
.navbar-btn.btn-sm {
  margin-top: 0px;
  margin-bottom: 0px;
}
.navbar-btn.btn-xs {
  margin-top: 4px;
  margin-bottom: 4px;
}
.navbar-text {
  margin-top: 6px;
  margin-bottom: 6px;
}
@media (min-width: 541px) {
  .navbar-text {
    float: left;
    margin-left: 0px;
    margin-right: 0px;
  }
}
@media (min-width: 541px) {
  .navbar-left {
    float: left !important;
    float: left;
  }
  .navbar-right {
    float: right !important;
    float: right;
    margin-right: 0px;
  }
  .navbar-right ~ .navbar-right {
    margin-right: 0;
  }
}
.navbar-default {
  background-color: #f8f8f8;
  border-color: #e7e7e7;
}
.navbar-default .navbar-brand {
  color: #777;
}
.navbar-default .navbar-brand:hover,
.navbar-default .navbar-brand:focus {
  color: #5e5e5e;
  background-color: transparent;
}
.navbar-default .navbar-text {
  color: #777;
}
.navbar-default .navbar-nav > li > a {
  color: #777;
}
.navbar-default .navbar-nav > li > a:hover,
.navbar-default .navbar-nav > li > a:focus {
  color: #333;
  background-color: transparent;
}
.navbar-default .navbar-nav > .active > a,
.navbar-default .navbar-nav > .active > a:hover,
.navbar-default .navbar-nav > .active > a:focus {
  color: #555;
  background-color: #e7e7e7;
}
.navbar-default .navbar-nav > .disabled > a,
.navbar-default .navbar-nav > .disabled > a:hover,
.navbar-default .navbar-nav > .disabled > a:focus {
  color: #ccc;
  background-color: transparent;
}
.navbar-default .navbar-toggle {
  border-color: #ddd;
}
.navbar-default .navbar-toggle:hover,
.navbar-default .navbar-toggle:focus {
  background-color: #ddd;
}
.navbar-default .navbar-toggle .icon-bar {
  background-color: #888;
}
.navbar-default .navbar-collapse,
.navbar-default .navbar-form {
  border-color: #e7e7e7;
}
.navbar-default .navbar-nav > .open > a,
.navbar-default .navbar-nav > .open > a:hover,
.navbar-default .navbar-nav > .open > a:focus {
  background-color: #e7e7e7;
  color: #555;
}
@media (max-width: 540px) {
  .navbar-default .navbar-nav .open .dropdown-menu > li > a {
    color: #777;
  }
  .navbar-default .navbar-nav .open .dropdown-menu > li > a:hover,
  .navbar-default .navbar-nav .open .dropdown-menu > li > a:focus {
    color: #333;
    background-color: transparent;
  }
  .navbar-default .navbar-nav .open .dropdown-menu > .active > a,
  .navbar-default .navbar-nav .open .dropdown-menu > .active > a:hover,
  .navbar-default .navbar-nav .open .dropdown-menu > .active > a:focus {
    color: #555;
    background-color: #e7e7e7;
  }
  .navbar-default .navbar-nav .open .dropdown-menu > .disabled > a,
  .navbar-default .navbar-nav .open .dropdown-menu > .disabled > a:hover,
  .navbar-default .navbar-nav .open .dropdown-menu > .disabled > a:focus {
    color: #ccc;
    background-color: transparent;
  }
}
.navbar-default .navbar-link {
  color: #777;
}
.navbar-default .navbar-link:hover {
  color: #333;
}
.navbar-default .btn-link {
  color: #777;
}
.navbar-default .btn-link:hover,
.navbar-default .btn-link:focus {
  color: #333;
}
.navbar-default .btn-link[disabled]:hover,
fieldset[disabled] .navbar-default .btn-link:hover,
.navbar-default .btn-link[disabled]:focus,
fieldset[disabled] .navbar-default .btn-link:focus {
  color: #ccc;
}
.navbar-inverse {
  background-color: #222;
  border-color: #080808;
}
.navbar-inverse .navbar-brand {
  color: #9d9d9d;
}
.navbar-inverse .navbar-brand:hover,
.navbar-inverse .navbar-brand:focus {
  color: #fff;
  background-color: transparent;
}
.navbar-inverse .navbar-text {
  color: #9d9d9d;
}
.navbar-inverse .navbar-nav > li > a {
  color: #9d9d9d;
}
.navbar-inverse .navbar-nav > li > a:hover,
.navbar-inverse .navbar-nav > li > a:focus {
  color: #fff;
  background-color: transparent;
}
.navbar-inverse .navbar-nav > .active > a,
.navbar-inverse .navbar-nav > .active > a:hover,
.navbar-inverse .navbar-nav > .active > a:focus {
  color: #fff;
  background-color: #080808;
}
.navbar-inverse .navbar-nav > .disabled > a,
.navbar-inverse .navbar-nav > .disabled > a:hover,
.navbar-inverse .navbar-nav > .disabled > a:focus {
  color: #444;
  background-color: transparent;
}
.navbar-inverse .navbar-toggle {
  border-color: #333;
}
.navbar-inverse .navbar-toggle:hover,
.navbar-inverse .navbar-toggle:focus {
  background-color: #333;
}
.navbar-inverse .navbar-toggle .icon-bar {
  background-color: #fff;
}
.navbar-inverse .navbar-collapse,
.navbar-inverse .navbar-form {
  border-color: #101010;
}
.navbar-inverse .navbar-nav > .open > a,
.navbar-inverse .navbar-nav > .open > a:hover,
.navbar-inverse .navbar-nav > .open > a:focus {
  background-color: #080808;
  color: #fff;
}
@media (max-width: 540px) {
  .navbar-inverse .navbar-nav .open .dropdown-menu > .dropdown-header {
    border-color: #080808;
  }
  .navbar-inverse .navbar-nav .open .dropdown-menu .divider {
    background-color: #080808;
  }
  .navbar-inverse .navbar-nav .open .dropdown-menu > li > a {
    color: #9d9d9d;
  }
  .navbar-inverse .navbar-nav .open .dropdown-menu > li > a:hover,
  .navbar-inverse .navbar-nav .open .dropdown-menu > li > a:focus {
    color: #fff;
    background-color: transparent;
  }
  .navbar-inverse .navbar-nav .open .dropdown-menu > .active > a,
  .navbar-inverse .navbar-nav .open .dropdown-menu > .active > a:hover,
  .navbar-inverse .navbar-nav .open .dropdown-menu > .active > a:focus {
    color: #fff;
    background-color: #080808;
  }
  .navbar-inverse .navbar-nav .open .dropdown-menu > .disabled > a,
  .navbar-inverse .navbar-nav .open .dropdown-menu > .disabled > a:hover,
  .navbar-inverse .navbar-nav .open .dropdown-menu > .disabled > a:focus {
    color: #444;
    background-color: transparent;
  }
}
.navbar-inverse .navbar-link {
  color: #9d9d9d;
}
.navbar-inverse .navbar-link:hover {
  color: #fff;
}
.navbar-inverse .btn-link {
  color: #9d9d9d;
}
.navbar-inverse .btn-link:hover,
.navbar-inverse .btn-link:focus {
  color: #fff;
}
.navbar-inverse .btn-link[disabled]:hover,
fieldset[disabled] .navbar-inverse .btn-link:hover,
.navbar-inverse .btn-link[disabled]:focus,
fieldset[disabled] .navbar-inverse .btn-link:focus {
  color: #444;
}
.breadcrumb {
  padding: 8px 15px;
  margin-bottom: 18px;
  list-style: none;
  background-color: #f5f5f5;
  border-radius: 2px;
}
.breadcrumb > li {
  display: inline-block;
}
.breadcrumb > li + li:before {
  content: "/\00a0";
  padding: 0 5px;
  color: #5e5e5e;
}
.breadcrumb > .active {
  color: #777777;
}
.pagination {
  display: inline-block;
  padding-left: 0;
  margin: 18px 0;
  border-radius: 2px;
}
.pagination > li {
  display: inline;
}
.pagination > li > a,
.pagination > li > span {
  position: relative;
  float: left;
  padding: 6px 12px;
  line-height: 1.42857143;
  text-decoration: none;
  color: #337ab7;
  background-color: #fff;
  border: 1px solid #ddd;
  margin-left: -1px;
}
.pagination > li:first-child > a,
.pagination > li:first-child > span {
  margin-left: 0;
  border-bottom-left-radius: 2px;
  border-top-left-radius: 2px;
}
.pagination > li:last-child > a,
.pagination > li:last-child > span {
  border-bottom-right-radius: 2px;
  border-top-right-radius: 2px;
}
.pagination > li > a:hover,
.pagination > li > span:hover,
.pagination > li > a:focus,
.pagination > li > span:focus {
  z-index: 2;
  color: #23527c;
  background-color: #eeeeee;
  border-color: #ddd;
}
.pagination > .active > a,
.pagination > .active > span,
.pagination > .active > a:hover,
.pagination > .active > span:hover,
.pagination > .active > a:focus,
.pagination > .active > span:focus {
  z-index: 3;
  color: #fff;
  background-color: #337ab7;
  border-color: #337ab7;
  cursor: default;
}
.pagination > .disabled > span,
.pagination > .disabled > span:hover,
.pagination > .disabled > span:focus,
.pagination > .disabled > a,
.pagination > .disabled > a:hover,
.pagination > .disabled > a:focus {
  color: #777777;
  background-color: #fff;
  border-color: #ddd;
  cursor: not-allowed;
}
.pagination-lg > li > a,
.pagination-lg > li > span {
  padding: 10px 16px;
  font-size: 17px;
  line-height: 1.3333333;
}
.pagination-lg > li:first-child > a,
.pagination-lg > li:first-child > span {
  border-bottom-left-radius: 3px;
  border-top-left-radius: 3px;
}
.pagination-lg > li:last-child > a,
.pagination-lg > li:last-child > span {
  border-bottom-right-radius: 3px;
  border-top-right-radius: 3px;
}
.pagination-sm > li > a,
.pagination-sm > li > span {
  padding: 5px 10px;
  font-size: 12px;
  line-height: 1.5;
}
.pagination-sm > li:first-child > a,
.pagination-sm > li:first-child > span {
  border-bottom-left-radius: 1px;
  border-top-left-radius: 1px;
}
.pagination-sm > li:last-child > a,
.pagination-sm > li:last-child > span {
  border-bottom-right-radius: 1px;
  border-top-right-radius: 1px;
}
.pager {
  padding-left: 0;
  margin: 18px 0;
  list-style: none;
  text-align: center;
}
.pager li {
  display: inline;
}
.pager li > a,
.pager li > span {
  display: inline-block;
  padding: 5px 14px;
  background-color: #fff;
  border: 1px solid #ddd;
  border-radius: 15px;
}
.pager li > a:hover,
.pager li > a:focus {
  text-decoration: none;
  background-color: #eeeeee;
}
.pager .next > a,
.pager .next > span {
  float: right;
}
.pager .previous > a,
.pager .previous > span {
  float: left;
}
.pager .disabled > a,
.pager .disabled > a:hover,
.pager .disabled > a:focus,
.pager .disabled > span {
  color: #777777;
  background-color: #fff;
  cursor: not-allowed;
}
.label {
  display: inline;
  padding: .2em .6em .3em;
  font-size: 75%;
  font-weight: bold;
  line-height: 1;
  color: #fff;
  text-align: center;
  white-space: nowrap;
  vertical-align: baseline;
  border-radius: .25em;
}
a.label:hover,
a.label:focus {
  color: #fff;
  text-decoration: none;
  cursor: pointer;
}
.label:empty {
  display: none;
}
.btn .label {
  position: relative;
  top: -1px;
}
.label-default {
  background-color: #777777;
}
.label-default[href]:hover,
.label-default[href]:focus {
  background-color: #5e5e5e;
}
.label-primary {
  background-color: #337ab7;
}
.label-primary[href]:hover,
.label-primary[href]:focus {
  background-color: #286090;
}
.label-success {
  background-color: #5cb85c;
}
.label-success[href]:hover,
.label-success[href]:focus {
  background-color: #449d44;
}
.label-info {
  background-color: #5bc0de;
}
.label-info[href]:hover,
.label-info[href]:focus {
  background-color: #31b0d5;
}
.label-warning {
  background-color: #f0ad4e;
}
.label-warning[href]:hover,
.label-warning[href]:focus {
  background-color: #ec971f;
}
.label-danger {
  background-color: #d9534f;
}
.label-danger[href]:hover,
.label-danger[href]:focus {
  background-color: #c9302c;
}
.badge {
  display: inline-block;
  min-width: 10px;
  padding: 3px 7px;
  font-size: 12px;
  font-weight: bold;
  color: #fff;
  line-height: 1;
  vertical-align: middle;
  white-space: nowrap;
  text-align: center;
  background-color: #777777;
  border-radius: 10px;
}
.badge:empty {
  display: none;
}
.btn .badge {
  position: relative;
  top: -1px;
}
.btn-xs .badge,
.btn-group-xs > .btn .badge {
  top: 0;
  padding: 1px 5px;
}
a.badge:hover,
a.badge:focus {
  color: #fff;
  text-decoration: none;
  cursor: pointer;
}
.list-group-item.active > .badge,
.nav-pills > .active > a > .badge {
  color: #337ab7;
  background-color: #fff;
}
.list-group-item > .badge {
  float: right;
}
.list-group-item > .badge + .badge {
  margin-right: 5px;
}
.nav-pills > li > a > .badge {
  margin-left: 3px;
}
.jumbotron {
  padding-top: 30px;
  padding-bottom: 30px;
  margin-bottom: 30px;
  color: inherit;
  background-color: #eeeeee;
}
.jumbotron h1,
.jumbotron .h1 {
  color: inherit;
}
.jumbotron p {
  margin-bottom: 15px;
  font-size: 20px;
  font-weight: 200;
}
.jumbotron > hr {
  border-top-color: #d5d5d5;
}
.container .jumbotron,
.container-fluid .jumbotron {
  border-radius: 3px;
  padding-left: 0px;
  padding-right: 0px;
}
.jumbotron .container {
  max-width: 100%;
}
@media screen and (min-width: 768px) {
  .jumbotron {
    padding-top: 48px;
    padding-bottom: 48px;
  }
  .container .jumbotron,
  .container-fluid .jumbotron {
    padding-left: 60px;
    padding-right: 60px;
  }
  .jumbotron h1,
  .jumbotron .h1 {
    font-size: 59px;
  }
}
.thumbnail {
  display: block;
  padding: 4px;
  margin-bottom: 18px;
  line-height: 1.42857143;
  background-color: #fff;
  border: 1px solid #ddd;
  border-radius: 2px;
  -webkit-transition: border 0.2s ease-in-out;
  -o-transition: border 0.2s ease-in-out;
  transition: border 0.2s ease-in-out;
}
.thumbnail > img,
.thumbnail a > img {
  margin-left: auto;
  margin-right: auto;
}
a.thumbnail:hover,
a.thumbnail:focus,
a.thumbnail.active {
  border-color: #337ab7;
}
.thumbnail .caption {
  padding: 9px;
  color: #000;
}
.alert {
  padding: 15px;
  margin-bottom: 18px;
  border: 1px solid transparent;
  border-radius: 2px;
}
.alert h4 {
  margin-top: 0;
  color: inherit;
}
.alert .alert-link {
  font-weight: bold;
}
.alert > p,
.alert > ul {
  margin-bottom: 0;
}
.alert > p + p {
  margin-top: 5px;
}
.alert-dismissable,
.alert-dismissible {
  padding-right: 35px;
}
.alert-dismissable .close,
.alert-dismissible .close {
  position: relative;
  top: -2px;
  right: -21px;
  color: inherit;
}
.alert-success {
  background-color: #dff0d8;
  border-color: #d6e9c6;
  color: #3c763d;
}
.alert-success hr {
  border-top-color: #c9e2b3;
}
.alert-success .alert-link {
  color: #2b542c;
}
.alert-info {
  background-color: #d9edf7;
  border-color: #bce8f1;
  color: #31708f;
}
.alert-info hr {
  border-top-color: #a6e1ec;
}
.alert-info .alert-link {
  color: #245269;
}
.alert-warning {
  background-color: #fcf8e3;
  border-color: #faebcc;
  color: #8a6d3b;
}
.alert-warning hr {
  border-top-color: #f7e1b5;
}
.alert-warning .alert-link {
  color: #66512c;
}
.alert-danger {
  background-color: #f2dede;
  border-color: #ebccd1;
  color: #a94442;
}
.alert-danger hr {
  border-top-color: #e4b9c0;
}
.alert-danger .alert-link {
  color: #843534;
}
@-webkit-keyframes progress-bar-stripes {
  from {
    background-position: 40px 0;
  }
  to {
    background-position: 0 0;
  }
}
@keyframes progress-bar-stripes {
  from {
    background-position: 40px 0;
  }
  to {
    background-position: 0 0;
  }
}
.progress {
  overflow: hidden;
  height: 18px;
  margin-bottom: 18px;
  background-color: #f5f5f5;
  border-radius: 2px;
  -webkit-box-shadow: inset 0 1px 2px rgba(0, 0, 0, 0.1);
  box-shadow: inset 0 1px 2px rgba(0, 0, 0, 0.1);
}
.progress-bar {
  float: left;
  width: 0%;
  height: 100%;
  font-size: 12px;
  line-height: 18px;
  color: #fff;
  text-align: center;
  background-color: #337ab7;
  -webkit-box-shadow: inset 0 -1px 0 rgba(0, 0, 0, 0.15);
  box-shadow: inset 0 -1px 0 rgba(0, 0, 0, 0.15);
  -webkit-transition: width 0.6s ease;
  -o-transition: width 0.6s ease;
  transition: width 0.6s ease;
}
.progress-striped .progress-bar,
.progress-bar-striped {
  background-image: -webkit-linear-gradient(45deg, rgba(255, 255, 255, 0.15) 25%, transparent 25%, transparent 50%, rgba(255, 255, 255, 0.15) 50%, rgba(255, 255, 255, 0.15) 75%, transparent 75%, transparent);
  background-image: -o-linear-gradient(45deg, rgba(255, 255, 255, 0.15) 25%, transparent 25%, transparent 50%, rgba(255, 255, 255, 0.15) 50%, rgba(255, 255, 255, 0.15) 75%, transparent 75%, transparent);
  background-image: linear-gradient(45deg, rgba(255, 255, 255, 0.15) 25%, transparent 25%, transparent 50%, rgba(255, 255, 255, 0.15) 50%, rgba(255, 255, 255, 0.15) 75%, transparent 75%, transparent);
  background-size: 40px 40px;
}
.progress.active .progress-bar,
.progress-bar.active {
  -webkit-animation: progress-bar-stripes 2s linear infinite;
  -o-animation: progress-bar-stripes 2s linear infinite;
  animation: progress-bar-stripes 2s linear infinite;
}
.progress-bar-success {
  background-color: #5cb85c;
}
.progress-striped .progress-bar-success {
  background-image: -webkit-linear-gradient(45deg, rgba(255, 255, 255, 0.15) 25%, transparent 25%, transparent 50%, rgba(255, 255, 255, 0.15) 50%, rgba(255, 255, 255, 0.15) 75%, transparent 75%, transparent);
  background-image: -o-linear-gradient(45deg, rgba(255, 255, 255, 0.15) 25%, transparent 25%, transparent 50%, rgba(255, 255, 255, 0.15) 50%, rgba(255, 255, 255, 0.15) 75%, transparent 75%, transparent);
  background-image: linear-gradient(45deg, rgba(255, 255, 255, 0.15) 25%, transparent 25%, transparent 50%, rgba(255, 255, 255, 0.15) 50%, rgba(255, 255, 255, 0.15) 75%, transparent 75%, transparent);
}
.progress-bar-info {
  background-color: #5bc0de;
}
.progress-striped .progress-bar-info {
  background-image: -webkit-linear-gradient(45deg, rgba(255, 255, 255, 0.15) 25%, transparent 25%, transparent 50%, rgba(255, 255, 255, 0.15) 50%, rgba(255, 255, 255, 0.15) 75%, transparent 75%, transparent);
  background-image: -o-linear-gradient(45deg, rgba(255, 255, 255, 0.15) 25%, transparent 25%, transparent 50%, rgba(255, 255, 255, 0.15) 50%, rgba(255, 255, 255, 0.15) 75%, transparent 75%, transparent);
  background-image: linear-gradient(45deg, rgba(255, 255, 255, 0.15) 25%, transparent 25%, transparent 50%, rgba(255, 255, 255, 0.15) 50%, rgba(255, 255, 255, 0.15) 75%, transparent 75%, transparent);
}
.progress-bar-warning {
  background-color: #f0ad4e;
}
.progress-striped .progress-bar-warning {
  background-image: -webkit-linear-gradient(45deg, rgba(255, 255, 255, 0.15) 25%, transparent 25%, transparent 50%, rgba(255, 255, 255, 0.15) 50%, rgba(255, 255, 255, 0.15) 75%, transparent 75%, transparent);
  background-image: -o-linear-gradient(45deg, rgba(255, 255, 255, 0.15) 25%, transparent 25%, transparent 50%, rgba(255, 255, 255, 0.15) 50%, rgba(255, 255, 255, 0.15) 75%, transparent 75%, transparent);
  background-image: linear-gradient(45deg, rgba(255, 255, 255, 0.15) 25%, transparent 25%, transparent 50%, rgba(255, 255, 255, 0.15) 50%, rgba(255, 255, 255, 0.15) 75%, transparent 75%, transparent);
}
.progress-bar-danger {
  background-color: #d9534f;
}
.progress-striped .progress-bar-danger {
  background-image: -webkit-linear-gradient(45deg, rgba(255, 255, 255, 0.15) 25%, transparent 25%, transparent 50%, rgba(255, 255, 255, 0.15) 50%, rgba(255, 255, 255, 0.15) 75%, transparent 75%, transparent);
  background-image: -o-linear-gradient(45deg, rgba(255, 255, 255, 0.15) 25%, transparent 25%, transparent 50%, rgba(255, 255, 255, 0.15) 50%, rgba(255, 255, 255, 0.15) 75%, transparent 75%, transparent);
  background-image: linear-gradient(45deg, rgba(255, 255, 255, 0.15) 25%, transparent 25%, transparent 50%, rgba(255, 255, 255, 0.15) 50%, rgba(255, 255, 255, 0.15) 75%, transparent 75%, transparent);
}
.media {
  margin-top: 15px;
}
.media:first-child {
  margin-top: 0;
}
.media,
.media-body {
  zoom: 1;
  overflow: hidden;
}
.media-body {
  width: 10000px;
}
.media-object {
  display: block;
}
.media-object.img-thumbnail {
  max-width: none;
}
.media-right,
.media > .pull-right {
  padding-left: 10px;
}
.media-left,
.media > .pull-left {
  padding-right: 10px;
}
.media-left,
.media-right,
.media-body {
  display: table-cell;
  vertical-align: top;
}
.media-middle {
  vertical-align: middle;
}
.media-bottom {
  vertical-align: bottom;
}
.media-heading {
  margin-top: 0;
  margin-bottom: 5px;
}
.media-list {
  padding-left: 0;
  list-style: none;
}
.list-group {
  margin-bottom: 20px;
  padding-left: 0;
}
.list-group-item {
  position: relative;
  display: block;
  padding: 10px 15px;
  margin-bottom: -1px;
  background-color: #fff;
  border: 1px solid #ddd;
}
.list-group-item:first-child {
  border-top-right-radius: 2px;
  border-top-left-radius: 2px;
}
.list-group-item:last-child {
  margin-bottom: 0;
  border-bottom-right-radius: 2px;
  border-bottom-left-radius: 2px;
}
a.list-group-item,
button.list-group-item {
  color: #555;
}
a.list-group-item .list-group-item-heading,
button.list-group-item .list-group-item-heading {
  color: #333;
}
a.list-group-item:hover,
button.list-group-item:hover,
a.list-group-item:focus,
button.list-group-item:focus {
  text-decoration: none;
  color: #555;
  background-color: #f5f5f5;
}
button.list-group-item {
  width: 100%;
  text-align: left;
}
.list-group-item.disabled,
.list-group-item.disabled:hover,
.list-group-item.disabled:focus {
  background-color: #eeeeee;
  color: #777777;
  cursor: not-allowed;
}
.list-group-item.disabled .list-group-item-heading,
.list-group-item.disabled:hover .list-group-item-heading,
.list-group-item.disabled:focus .list-group-item-heading {
  color: inherit;
}
.list-group-item.disabled .list-group-item-text,
.list-group-item.disabled:hover .list-group-item-text,
.list-group-item.disabled:focus .list-group-item-text {
  color: #777777;
}
.list-group-item.active,
.list-group-item.active:hover,
.list-group-item.active:focus {
  z-index: 2;
  color: #fff;
  background-color: #337ab7;
  border-color: #337ab7;
}
.list-group-item.active .list-group-item-heading,
.list-group-item.active:hover .list-group-item-heading,
.list-group-item.active:focus .list-group-item-heading,
.list-group-item.active .list-group-item-heading > small,
.list-group-item.active:hover .list-group-item-heading > small,
.list-group-item.active:focus .list-group-item-heading > small,
.list-group-item.active .list-group-item-heading > .small,
.list-group-item.active:hover .list-group-item-heading > .small,
.list-group-item.active:focus .list-group-item-heading > .small {
  color: inherit;
}
.list-group-item.active .list-group-item-text,
.list-group-item.active:hover .list-group-item-text,
.list-group-item.active:focus .list-group-item-text {
  color: #c7ddef;
}
.list-group-item-success {
  color: #3c763d;
  background-color: #dff0d8;
}
a.list-group-item-success,
button.list-group-item-success {
  color: #3c763d;
}
a.list-group-item-success .list-group-item-heading,
button.list-group-item-success .list-group-item-heading {
  color: inherit;
}
a.list-group-item-success:hover,
button.list-group-item-success:hover,
a.list-group-item-success:focus,
button.list-group-item-success:focus {
  color: #3c763d;
  background-color: #d0e9c6;
}
a.list-group-item-success.active,
button.list-group-item-success.active,
a.list-group-item-success.active:hover,
button.list-group-item-success.active:hover,
a.list-group-item-success.active:focus,
button.list-group-item-success.active:focus {
  color: #fff;
  background-color: #3c763d;
  border-color: #3c763d;
}
.list-group-item-info {
  color: #31708f;
  background-color: #d9edf7;
}
a.list-group-item-info,
button.list-group-item-info {
  color: #31708f;
}
a.list-group-item-info .list-group-item-heading,
button.list-group-item-info .list-group-item-heading {
  color: inherit;
}
a.list-group-item-info:hover,
button.list-group-item-info:hover,
a.list-group-item-info:focus,
button.list-group-item-info:focus {
  color: #31708f;
  background-color: #c4e3f3;
}
a.list-group-item-info.active,
button.list-group-item-info.active,
a.list-group-item-info.active:hover,
button.list-group-item-info.active:hover,
a.list-group-item-info.active:focus,
button.list-group-item-info.active:focus {
  color: #fff;
  background-color: #31708f;
  border-color: #31708f;
}
.list-group-item-warning {
  color: #8a6d3b;
  background-color: #fcf8e3;
}
a.list-group-item-warning,
button.list-group-item-warning {
  color: #8a6d3b;
}
a.list-group-item-warning .list-group-item-heading,
button.list-group-item-warning .list-group-item-heading {
  color: inherit;
}
a.list-group-item-warning:hover,
button.list-group-item-warning:hover,
a.list-group-item-warning:focus,
button.list-group-item-warning:focus {
  color: #8a6d3b;
  background-color: #faf2cc;
}
a.list-group-item-warning.active,
button.list-group-item-warning.active,
a.list-group-item-warning.active:hover,
button.list-group-item-warning.active:hover,
a.list-group-item-warning.active:focus,
button.list-group-item-warning.active:focus {
  color: #fff;
  background-color: #8a6d3b;
  border-color: #8a6d3b;
}
.list-group-item-danger {
  color: #a94442;
  background-color: #f2dede;
}
a.list-group-item-danger,
button.list-group-item-danger {
  color: #a94442;
}
a.list-group-item-danger .list-group-item-heading,
button.list-group-item-danger .list-group-item-heading {
  color: inherit;
}
a.list-group-item-danger:hover,
button.list-group-item-danger:hover,
a.list-group-item-danger:focus,
button.list-group-item-danger:focus {
  color: #a94442;
  background-color: #ebcccc;
}
a.list-group-item-danger.active,
button.list-group-item-danger.active,
a.list-group-item-danger.active:hover,
button.list-group-item-danger.active:hover,
a.list-group-item-danger.active:focus,
button.list-group-item-danger.active:focus {
  color: #fff;
  background-color: #a94442;
  border-color: #a94442;
}
.list-group-item-heading {
  margin-top: 0;
  margin-bottom: 5px;
}
.list-group-item-text {
  margin-bottom: 0;
  line-height: 1.3;
}
.panel {
  margin-bottom: 18px;
  background-color: #fff;
  border: 1px solid transparent;
  border-radius: 2px;
  -webkit-box-shadow: 0 1px 1px rgba(0, 0, 0, 0.05);
  box-shadow: 0 1px 1px rgba(0, 0, 0, 0.05);
}
.panel-body {
  padding: 15px;
}
.panel-heading {
  padding: 10px 15px;
  border-bottom: 1px solid transparent;
  border-top-right-radius: 1px;
  border-top-left-radius: 1px;
}
.panel-heading > .dropdown .dropdown-toggle {
  color: inherit;
}
.panel-title {
  margin-top: 0;
  margin-bottom: 0;
  font-size: 15px;
  color: inherit;
}
.panel-title > a,
.panel-title > small,
.panel-title > .small,
.panel-title > small > a,
.panel-title > .small > a {
  color: inherit;
}
.panel-footer {
  padding: 10px 15px;
  background-color: #f5f5f5;
  border-top: 1px solid #ddd;
  border-bottom-right-radius: 1px;
  border-bottom-left-radius: 1px;
}
.panel > .list-group,
.panel > .panel-collapse > .list-group {
  margin-bottom: 0;
}
.panel > .list-group .list-group-item,
.panel > .panel-collapse > .list-group .list-group-item {
  border-width: 1px 0;
  border-radius: 0;
}
.panel > .list-group:first-child .list-group-item:first-child,
.panel > .panel-collapse > .list-group:first-child .list-group-item:first-child {
  border-top: 0;
  border-top-right-radius: 1px;
  border-top-left-radius: 1px;
}
.panel > .list-group:last-child .list-group-item:last-child,
.panel > .panel-collapse > .list-group:last-child .list-group-item:last-child {
  border-bottom: 0;
  border-bottom-right-radius: 1px;
  border-bottom-left-radius: 1px;
}
.panel > .panel-heading + .panel-collapse > .list-group .list-group-item:first-child {
  border-top-right-radius: 0;
  border-top-left-radius: 0;
}
.panel-heading + .list-group .list-group-item:first-child {
  border-top-width: 0;
}
.list-group + .panel-footer {
  border-top-width: 0;
}
.panel > .table,
.panel > .table-responsive > .table,
.panel > .panel-collapse > .table {
  margin-bottom: 0;
}
.panel > .table caption,
.panel > .table-responsive > .table caption,
.panel > .panel-collapse > .table caption {
  padding-left: 15px;
  padding-right: 15px;
}
.panel > .table:first-child,
.panel > .table-responsive:first-child > .table:first-child {
  border-top-right-radius: 1px;
  border-top-left-radius: 1px;
}
.panel > .table:first-child > thead:first-child > tr:first-child,
.panel > .table-responsive:first-child > .table:first-child > thead:first-child > tr:first-child,
.panel > .table:first-child > tbody:first-child > tr:first-child,
.panel > .table-responsive:first-child > .table:first-child > tbody:first-child > tr:first-child {
  border-top-left-radius: 1px;
  border-top-right-radius: 1px;
}
.panel > .table:first-child > thead:first-child > tr:first-child td:first-child,
.panel > .table-responsive:first-child > .table:first-child > thead:first-child > tr:first-child td:first-child,
.panel > .table:first-child > tbody:first-child > tr:first-child td:first-child,
.panel > .table-responsive:first-child > .table:first-child > tbody:first-child > tr:first-child td:first-child,
.panel > .table:first-child > thead:first-child > tr:first-child th:first-child,
.panel > .table-responsive:first-child > .table:first-child > thead:first-child > tr:first-child th:first-child,
.panel > .table:first-child > tbody:first-child > tr:first-child th:first-child,
.panel > .table-responsive:first-child > .table:first-child > tbody:first-child > tr:first-child th:first-child {
  border-top-left-radius: 1px;
}
.panel > .table:first-child > thead:first-child > tr:first-child td:last-child,
.panel > .table-responsive:first-child > .table:first-child > thead:first-child > tr:first-child td:last-child,
.panel > .table:first-child > tbody:first-child > tr:first-child td:last-child,
.panel > .table-responsive:first-child > .table:first-child > tbody:first-child > tr:first-child td:last-child,
.panel > .table:first-child > thead:first-child > tr:first-child th:last-child,
.panel > .table-responsive:first-child > .table:first-child > thead:first-child > tr:first-child th:last-child,
.panel > .table:first-child > tbody:first-child > tr:first-child th:last-child,
.panel > .table-responsive:first-child > .table:first-child > tbody:first-child > tr:first-child th:last-child {
  border-top-right-radius: 1px;
}
.panel > .table:last-child,
.panel > .table-responsive:last-child > .table:last-child {
  border-bottom-right-radius: 1px;
  border-bottom-left-radius: 1px;
}
.panel > .table:last-child > tbody:last-child > tr:last-child,
.panel > .table-responsive:last-child > .table:last-child > tbody:last-child > tr:last-child,
.panel > .table:last-child > tfoot:last-child > tr:last-child,
.panel > .table-responsive:last-child > .table:last-child > tfoot:last-child > tr:last-child {
  border-bottom-left-radius: 1px;
  border-bottom-right-radius: 1px;
}
.panel > .table:last-child > tbody:last-child > tr:last-child td:first-child,
.panel > .table-responsive:last-child > .table:last-child > tbody:last-child > tr:last-child td:first-child,
.panel > .table:last-child > tfoot:last-child > tr:last-child td:first-child,
.panel > .table-responsive:last-child > .table:last-child > tfoot:last-child > tr:last-child td:first-child,
.panel > .table:last-child > tbody:last-child > tr:last-child th:first-child,
.panel > .table-responsive:last-child > .table:last-child > tbody:last-child > tr:last-child th:first-child,
.panel > .table:last-child > tfoot:last-child > tr:last-child th:first-child,
.panel > .table-responsive:last-child > .table:last-child > tfoot:last-child > tr:last-child th:first-child {
  border-bottom-left-radius: 1px;
}
.panel > .table:last-child > tbody:last-child > tr:last-child td:last-child,
.panel > .table-responsive:last-child > .table:last-child > tbody:last-child > tr:last-child td:last-child,
.panel > .table:last-child > tfoot:last-child > tr:last-child td:last-child,
.panel > .table-responsive:last-child > .table:last-child > tfoot:last-child > tr:last-child td:last-child,
.panel > .table:last-child > tbody:last-child > tr:last-child th:last-child,
.panel > .table-responsive:last-child > .table:last-child > tbody:last-child > tr:last-child th:last-child,
.panel > .table:last-child > tfoot:last-child > tr:last-child th:last-child,
.panel > .table-responsive:last-child > .table:last-child > tfoot:last-child > tr:last-child th:last-child {
  border-bottom-right-radius: 1px;
}
.panel > .panel-body + .table,
.panel > .panel-body + .table-responsive,
.panel > .table + .panel-body,
.panel > .table-responsive + .panel-body {
  border-top: 1px solid #ddd;
}
.panel > .table > tbody:first-child > tr:first-child th,
.panel > .table > tbody:first-child > tr:first-child td {
  border-top: 0;
}
.panel > .table-bordered,
.panel > .table-responsive > .table-bordered {
  border: 0;
}
.panel > .table-bordered > thead > tr > th:first-child,
.panel > .table-responsive > .table-bordered > thead > tr > th:first-child,
.panel > .table-bordered > tbody > tr > th:first-child,
.panel > .table-responsive > .table-bordered > tbody > tr > th:first-child,
.panel > .table-bordered > tfoot > tr > th:first-child,
.panel > .table-responsive > .table-bordered > tfoot > tr > th:first-child,
.panel > .table-bordered > thead > tr > td:first-child,
.panel > .table-responsive > .table-bordered > thead > tr > td:first-child,
.panel > .table-bordered > tbody > tr > td:first-child,
.panel > .table-responsive > .table-bordered > tbody > tr > td:first-child,
.panel > .table-bordered > tfoot > tr > td:first-child,
.panel > .table-responsive > .table-bordered > tfoot > tr > td:first-child {
  border-left: 0;
}
.panel > .table-bordered > thead > tr > th:last-child,
.panel > .table-responsive > .table-bordered > thead > tr > th:last-child,
.panel > .table-bordered > tbody > tr > th:last-child,
.panel > .table-responsive > .table-bordered > tbody > tr > th:last-child,
.panel > .table-bordered > tfoot > tr > th:last-child,
.panel > .table-responsive > .table-bordered > tfoot > tr > th:last-child,
.panel > .table-bordered > thead > tr > td:last-child,
.panel > .table-responsive > .table-bordered > thead > tr > td:last-child,
.panel > .table-bordered > tbody > tr > td:last-child,
.panel > .table-responsive > .table-bordered > tbody > tr > td:last-child,
.panel > .table-bordered > tfoot > tr > td:last-child,
.panel > .table-responsive > .table-bordered > tfoot > tr > td:last-child {
  border-right: 0;
}
.panel > .table-bordered > thead > tr:first-child > td,
.panel > .table-responsive > .table-bordered > thead > tr:first-child > td,
.panel > .table-bordered > tbody > tr:first-child > td,
.panel > .table-responsive > .table-bordered > tbody > tr:first-child > td,
.panel > .table-bordered > thead > tr:first-child > th,
.panel > .table-responsive > .table-bordered > thead > tr:first-child > th,
.panel > .table-bordered > tbody > tr:first-child > th,
.panel > .table-responsive > .table-bordered > tbody > tr:first-child > th {
  border-bottom: 0;
}
.panel > .table-bordered > tbody > tr:last-child > td,
.panel > .table-responsive > .table-bordered > tbody > tr:last-child > td,
.panel > .table-bordered > tfoot > tr:last-child > td,
.panel > .table-responsive > .table-bordered > tfoot > tr:last-child > td,
.panel > .table-bordered > tbody > tr:last-child > th,
.panel > .table-responsive > .table-bordered > tbody > tr:last-child > th,
.panel > .table-bordered > tfoot > tr:last-child > th,
.panel > .table-responsive > .table-bordered > tfoot > tr:last-child > th {
  border-bottom: 0;
}
.panel > .table-responsive {
  border: 0;
  margin-bottom: 0;
}
.panel-group {
  margin-bottom: 18px;
}
.panel-group .panel {
  margin-bottom: 0;
  border-radius: 2px;
}
.panel-group .panel + .panel {
  margin-top: 5px;
}
.panel-group .panel-heading {
  border-bottom: 0;
}
.panel-group .panel-heading + .panel-collapse > .panel-body,
.panel-group .panel-heading + .panel-collapse > .list-group {
  border-top: 1px solid #ddd;
}
.panel-group .panel-footer {
  border-top: 0;
}
.panel-group .panel-footer + .panel-collapse .panel-body {
  border-bottom: 1px solid #ddd;
}
.panel-default {
  border-color: #ddd;
}
.panel-default > .panel-heading {
  color: #333333;
  background-color: #f5f5f5;
  border-color: #ddd;
}
.panel-default > .panel-heading + .panel-collapse > .panel-body {
  border-top-color: #ddd;
}
.panel-default > .panel-heading .badge {
  color: #f5f5f5;
  background-color: #333333;
}
.panel-default > .panel-footer + .panel-collapse > .panel-body {
  border-bottom-color: #ddd;
}
.panel-primary {
  border-color: #337ab7;
}
.panel-primary > .panel-heading {
  color: #fff;
  background-color: #337ab7;
  border-color: #337ab7;
}
.panel-primary > .panel-heading + .panel-collapse > .panel-body {
  border-top-color: #337ab7;
}
.panel-primary > .panel-heading .badge {
  color: #337ab7;
  background-color: #fff;
}
.panel-primary > .panel-footer + .panel-collapse > .panel-body {
  border-bottom-color: #337ab7;
}
.panel-success {
  border-color: #d6e9c6;
}
.panel-success > .panel-heading {
  color: #3c763d;
  background-color: #dff0d8;
  border-color: #d6e9c6;
}
.panel-success > .panel-heading + .panel-collapse > .panel-body {
  border-top-color: #d6e9c6;
}
.panel-success > .panel-heading .badge {
  color: #dff0d8;
  background-color: #3c763d;
}
.panel-success > .panel-footer + .panel-collapse > .panel-body {
  border-bottom-color: #d6e9c6;
}
.panel-info {
  border-color: #bce8f1;
}
.panel-info > .panel-heading {
  color: #31708f;
  background-color: #d9edf7;
  border-color: #bce8f1;
}
.panel-info > .panel-heading + .panel-collapse > .panel-body {
  border-top-color: #bce8f1;
}
.panel-info > .panel-heading .badge {
  color: #d9edf7;
  background-color: #31708f;
}
.panel-info > .panel-footer + .panel-collapse > .panel-body {
  border-bottom-color: #bce8f1;
}
.panel-warning {
  border-color: #faebcc;
}
.panel-warning > .panel-heading {
  color: #8a6d3b;
  background-color: #fcf8e3;
  border-color: #faebcc;
}
.panel-warning > .panel-heading + .panel-collapse > .panel-body {
  border-top-color: #faebcc;
}
.panel-warning > .panel-heading .badge {
  color: #fcf8e3;
  background-color: #8a6d3b;
}
.panel-warning > .panel-footer + .panel-collapse > .panel-body {
  border-bottom-color: #faebcc;
}
.panel-danger {
  border-color: #ebccd1;
}
.panel-danger > .panel-heading {
  color: #a94442;
  background-color: #f2dede;
  border-color: #ebccd1;
}
.panel-danger > .panel-heading + .panel-collapse > .panel-body {
  border-top-color: #ebccd1;
}
.panel-danger > .panel-heading .badge {
  color: #f2dede;
  background-color: #a94442;
}
.panel-danger > .panel-footer + .panel-collapse > .panel-body {
  border-bottom-color: #ebccd1;
}
.embed-responsive {
  position: relative;
  display: block;
  height: 0;
  padding: 0;
  overflow: hidden;
}
.embed-responsive .embed-responsive-item,
.embed-responsive iframe,
.embed-responsive embed,
.embed-responsive object,
.embed-responsive video {
  position: absolute;
  top: 0;
  left: 0;
  bottom: 0;
  height: 100%;
  width: 100%;
  border: 0;
}
.embed-responsive-16by9 {
  padding-bottom: 56.25%;
}
.embed-responsive-4by3 {
  padding-bottom: 75%;
}
.well {
  min-height: 20px;
  padding: 19px;
  margin-bottom: 20px;
  background-color: #f5f5f5;
  border: 1px solid #e3e3e3;
  border-radius: 2px;
  -webkit-box-shadow: inset 0 1px 1px rgba(0, 0, 0, 0.05);
  box-shadow: inset 0 1px 1px rgba(0, 0, 0, 0.05);
}
.well blockquote {
  border-color: #ddd;
  border-color: rgba(0, 0, 0, 0.15);
}
.well-lg {
  padding: 24px;
  border-radius: 3px;
}
.well-sm {
  padding: 9px;
  border-radius: 1px;
}
.close {
  float: right;
  font-size: 19.5px;
  font-weight: bold;
  line-height: 1;
  color: #000;
  text-shadow: 0 1px 0 #fff;
  opacity: 0.2;
  filter: alpha(opacity=20);
}
.close:hover,
.close:focus {
  color: #000;
  text-decoration: none;
  cursor: pointer;
  opacity: 0.5;
  filter: alpha(opacity=50);
}
button.close {
  padding: 0;
  cursor: pointer;
  background: transparent;
  border: 0;
  -webkit-appearance: none;
}
.modal-open {
  overflow: hidden;
}
.modal {
  display: none;
  overflow: hidden;
  position: fixed;
  top: 0;
  right: 0;
  bottom: 0;
  left: 0;
  z-index: 1050;
  -webkit-overflow-scrolling: touch;
  outline: 0;
}
.modal.fade .modal-dialog {
  -webkit-transform: translate(0, -25%);
  -ms-transform: translate(0, -25%);
  -o-transform: translate(0, -25%);
  transform: translate(0, -25%);
  -webkit-transition: -webkit-transform 0.3s ease-out;
  -moz-transition: -moz-transform 0.3s ease-out;
  -o-transition: -o-transform 0.3s ease-out;
  transition: transform 0.3s ease-out;
}
.modal.in .modal-dialog {
  -webkit-transform: translate(0, 0);
  -ms-transform: translate(0, 0);
  -o-transform: translate(0, 0);
  transform: translate(0, 0);
}
.modal-open .modal {
  overflow-x: hidden;
  overflow-y: auto;
}
.modal-dialog {
  position: relative;
  width: auto;
  margin: 10px;
}
.modal-content {
  position: relative;
  background-color: #fff;
  border: 1px solid #999;
  border: 1px solid rgba(0, 0, 0, 0.2);
  border-radius: 3px;
  -webkit-box-shadow: 0 3px 9px rgba(0, 0, 0, 0.5);
  box-shadow: 0 3px 9px rgba(0, 0, 0, 0.5);
  background-clip: padding-box;
  outline: 0;
}
.modal-backdrop {
  position: fixed;
  top: 0;
  right: 0;
  bottom: 0;
  left: 0;
  z-index: 1040;
  background-color: #000;
}
.modal-backdrop.fade {
  opacity: 0;
  filter: alpha(opacity=0);
}
.modal-backdrop.in {
  opacity: 0.5;
  filter: alpha(opacity=50);
}
.modal-header {
  padding: 15px;
  border-bottom: 1px solid #e5e5e5;
}
.modal-header .close {
  margin-top: -2px;
}
.modal-title {
  margin: 0;
  line-height: 1.42857143;
}
.modal-body {
  position: relative;
  padding: 15px;
}
.modal-footer {
  padding: 15px;
  text-align: right;
  border-top: 1px solid #e5e5e5;
}
.modal-footer .btn + .btn {
  margin-left: 5px;
  margin-bottom: 0;
}
.modal-footer .btn-group .btn + .btn {
  margin-left: -1px;
}
.modal-footer .btn-block + .btn-block {
  margin-left: 0;
}
.modal-scrollbar-measure {
  position: absolute;
  top: -9999px;
  width: 50px;
  height: 50px;
  overflow: scroll;
}
@media (min-width: 768px) {
  .modal-dialog {
    width: 600px;
    margin: 30px auto;
  }
  .modal-content {
    -webkit-box-shadow: 0 5px 15px rgba(0, 0, 0, 0.5);
    box-shadow: 0 5px 15px rgba(0, 0, 0, 0.5);
  }
  .modal-sm {
    width: 300px;
  }
}
@media (min-width: 992px) {
  .modal-lg {
    width: 900px;
  }
}
.tooltip {
  position: absolute;
  z-index: 1070;
  display: block;
  font-family: "Helvetica Neue", Helvetica, Arial, sans-serif;
  font-style: normal;
  font-weight: normal;
  letter-spacing: normal;
  line-break: auto;
  line-height: 1.42857143;
  text-align: left;
  text-align: start;
  text-decoration: none;
  text-shadow: none;
  text-transform: none;
  white-space: normal;
  word-break: normal;
  word-spacing: normal;
  word-wrap: normal;
  font-size: 12px;
  opacity: 0;
  filter: alpha(opacity=0);
}
.tooltip.in {
  opacity: 0.9;
  filter: alpha(opacity=90);
}
.tooltip.top {
  margin-top: -3px;
  padding: 5px 0;
}
.tooltip.right {
  margin-left: 3px;
  padding: 0 5px;
}
.tooltip.bottom {
  margin-top: 3px;
  padding: 5px 0;
}
.tooltip.left {
  margin-left: -3px;
  padding: 0 5px;
}
.tooltip-inner {
  max-width: 200px;
  padding: 3px 8px;
  color: #fff;
  text-align: center;
  background-color: #000;
  border-radius: 2px;
}
.tooltip-arrow {
  position: absolute;
  width: 0;
  height: 0;
  border-color: transparent;
  border-style: solid;
}
.tooltip.top .tooltip-arrow {
  bottom: 0;
  left: 50%;
  margin-left: -5px;
  border-width: 5px 5px 0;
  border-top-color: #000;
}
.tooltip.top-left .tooltip-arrow {
  bottom: 0;
  right: 5px;
  margin-bottom: -5px;
  border-width: 5px 5px 0;
  border-top-color: #000;
}
.tooltip.top-right .tooltip-arrow {
  bottom: 0;
  left: 5px;
  margin-bottom: -5px;
  border-width: 5px 5px 0;
  border-top-color: #000;
}
.tooltip.right .tooltip-arrow {
  top: 50%;
  left: 0;
  margin-top: -5px;
  border-width: 5px 5px 5px 0;
  border-right-color: #000;
}
.tooltip.left .tooltip-arrow {
  top: 50%;
  right: 0;
  margin-top: -5px;
  border-width: 5px 0 5px 5px;
  border-left-color: #000;
}
.tooltip.bottom .tooltip-arrow {
  top: 0;
  left: 50%;
  margin-left: -5px;
  border-width: 0 5px 5px;
  border-bottom-color: #000;
}
.tooltip.bottom-left .tooltip-arrow {
  top: 0;
  right: 5px;
  margin-top: -5px;
  border-width: 0 5px 5px;
  border-bottom-color: #000;
}
.tooltip.bottom-right .tooltip-arrow {
  top: 0;
  left: 5px;
  margin-top: -5px;
  border-width: 0 5px 5px;
  border-bottom-color: #000;
}
.popover {
  position: absolute;
  top: 0;
  left: 0;
  z-index: 1060;
  display: none;
  max-width: 276px;
  padding: 1px;
  font-family: "Helvetica Neue", Helvetica, Arial, sans-serif;
  font-style: normal;
  font-weight: normal;
  letter-spacing: normal;
  line-break: auto;
  line-height: 1.42857143;
  text-align: left;
  text-align: start;
  text-decoration: none;
  text-shadow: none;
  text-transform: none;
  white-space: normal;
  word-break: normal;
  word-spacing: normal;
  word-wrap: normal;
  font-size: 13px;
  background-color: #fff;
  background-clip: padding-box;
  border: 1px solid #ccc;
  border: 1px solid rgba(0, 0, 0, 0.2);
  border-radius: 3px;
  -webkit-box-shadow: 0 5px 10px rgba(0, 0, 0, 0.2);
  box-shadow: 0 5px 10px rgba(0, 0, 0, 0.2);
}
.popover.top {
  margin-top: -10px;
}
.popover.right {
  margin-left: 10px;
}
.popover.bottom {
  margin-top: 10px;
}
.popover.left {
  margin-left: -10px;
}
.popover-title {
  margin: 0;
  padding: 8px 14px;
  font-size: 13px;
  background-color: #f7f7f7;
  border-bottom: 1px solid #ebebeb;
  border-radius: 2px 2px 0 0;
}
.popover-content {
  padding: 9px 14px;
}
.popover > .arrow,
.popover > .arrow:after {
  position: absolute;
  display: block;
  width: 0;
  height: 0;
  border-color: transparent;
  border-style: solid;
}
.popover > .arrow {
  border-width: 11px;
}
.popover > .arrow:after {
  border-width: 10px;
  content: "";
}
.popover.top > .arrow {
  left: 50%;
  margin-left: -11px;
  border-bottom-width: 0;
  border-top-color: #999999;
  border-top-color: rgba(0, 0, 0, 0.25);
  bottom: -11px;
}
.popover.top > .arrow:after {
  content: " ";
  bottom: 1px;
  margin-left: -10px;
  border-bottom-width: 0;
  border-top-color: #fff;
}
.popover.right > .arrow {
  top: 50%;
  left: -11px;
  margin-top: -11px;
  border-left-width: 0;
  border-right-color: #999999;
  border-right-color: rgba(0, 0, 0, 0.25);
}
.popover.right > .arrow:after {
  content: " ";
  left: 1px;
  bottom: -10px;
  border-left-width: 0;
  border-right-color: #fff;
}
.popover.bottom > .arrow {
  left: 50%;
  margin-left: -11px;
  border-top-width: 0;
  border-bottom-color: #999999;
  border-bottom-color: rgba(0, 0, 0, 0.25);
  top: -11px;
}
.popover.bottom > .arrow:after {
  content: " ";
  top: 1px;
  margin-left: -10px;
  border-top-width: 0;
  border-bottom-color: #fff;
}
.popover.left > .arrow {
  top: 50%;
  right: -11px;
  margin-top: -11px;
  border-right-width: 0;
  border-left-color: #999999;
  border-left-color: rgba(0, 0, 0, 0.25);
}
.popover.left > .arrow:after {
  content: " ";
  right: 1px;
  border-right-width: 0;
  border-left-color: #fff;
  bottom: -10px;
}
.carousel {
  position: relative;
}
.carousel-inner {
  position: relative;
  overflow: hidden;
  width: 100%;
}
.carousel-inner > .item {
  display: none;
  position: relative;
  -webkit-transition: 0.6s ease-in-out left;
  -o-transition: 0.6s ease-in-out left;
  transition: 0.6s ease-in-out left;
}
.carousel-inner > .item > img,
.carousel-inner > .item > a > img {
  line-height: 1;
}
@media all and (transform-3d), (-webkit-transform-3d) {
  .carousel-inner > .item {
    -webkit-transition: -webkit-transform 0.6s ease-in-out;
    -moz-transition: -moz-transform 0.6s ease-in-out;
    -o-transition: -o-transform 0.6s ease-in-out;
    transition: transform 0.6s ease-in-out;
    -webkit-backface-visibility: hidden;
    -moz-backface-visibility: hidden;
    backface-visibility: hidden;
    -webkit-perspective: 1000px;
    -moz-perspective: 1000px;
    perspective: 1000px;
  }
  .carousel-inner > .item.next,
  .carousel-inner > .item.active.right {
    -webkit-transform: translate3d(100%, 0, 0);
    transform: translate3d(100%, 0, 0);
    left: 0;
  }
  .carousel-inner > .item.prev,
  .carousel-inner > .item.active.left {
    -webkit-transform: translate3d(-100%, 0, 0);
    transform: translate3d(-100%, 0, 0);
    left: 0;
  }
  .carousel-inner > .item.next.left,
  .carousel-inner > .item.prev.right,
  .carousel-inner > .item.active {
    -webkit-transform: translate3d(0, 0, 0);
    transform: translate3d(0, 0, 0);
    left: 0;
  }
}
.carousel-inner > .active,
.carousel-inner > .next,
.carousel-inner > .prev {
  display: block;
}
.carousel-inner > .active {
  left: 0;
}
.carousel-inner > .next,
.carousel-inner > .prev {
  position: absolute;
  top: 0;
  width: 100%;
}
.carousel-inner > .next {
  left: 100%;
}
.carousel-inner > .prev {
  left: -100%;
}
.carousel-inner > .next.left,
.carousel-inner > .prev.right {
  left: 0;
}
.carousel-inner > .active.left {
  left: -100%;
}
.carousel-inner > .active.right {
  left: 100%;
}
.carousel-control {
  position: absolute;
  top: 0;
  left: 0;
  bottom: 0;
  width: 15%;
  opacity: 0.5;
  filter: alpha(opacity=50);
  font-size: 20px;
  color: #fff;
  text-align: center;
  text-shadow: 0 1px 2px rgba(0, 0, 0, 0.6);
  background-color: rgba(0, 0, 0, 0);
}
.carousel-control.left {
  background-image: -webkit-linear-gradient(left, rgba(0, 0, 0, 0.5) 0%, rgba(0, 0, 0, 0.0001) 100%);
  background-image: -o-linear-gradient(left, rgba(0, 0, 0, 0.5) 0%, rgba(0, 0, 0, 0.0001) 100%);
  background-image: linear-gradient(to right, rgba(0, 0, 0, 0.5) 0%, rgba(0, 0, 0, 0.0001) 100%);
  background-repeat: repeat-x;
  filter: progid:DXImageTransform.Microsoft.gradient(startColorstr='#80000000', endColorstr='#00000000', GradientType=1);
}
.carousel-control.right {
  left: auto;
  right: 0;
  background-image: -webkit-linear-gradient(left, rgba(0, 0, 0, 0.0001) 0%, rgba(0, 0, 0, 0.5) 100%);
  background-image: -o-linear-gradient(left, rgba(0, 0, 0, 0.0001) 0%, rgba(0, 0, 0, 0.5) 100%);
  background-image: linear-gradient(to right, rgba(0, 0, 0, 0.0001) 0%, rgba(0, 0, 0, 0.5) 100%);
  background-repeat: repeat-x;
  filter: progid:DXImageTransform.Microsoft.gradient(startColorstr='#00000000', endColorstr='#80000000', GradientType=1);
}
.carousel-control:hover,
.carousel-control:focus {
  outline: 0;
  color: #fff;
  text-decoration: none;
  opacity: 0.9;
  filter: alpha(opacity=90);
}
.carousel-control .icon-prev,
.carousel-control .icon-next,
.carousel-control .glyphicon-chevron-left,
.carousel-control .glyphicon-chevron-right {
  position: absolute;
  top: 50%;
  margin-top: -10px;
  z-index: 5;
  display: inline-block;
}
.carousel-control .icon-prev,
.carousel-control .glyphicon-chevron-left {
  left: 50%;
  margin-left: -10px;
}
.carousel-control .icon-next,
.carousel-control .glyphicon-chevron-right {
  right: 50%;
  margin-right: -10px;
}
.carousel-control .icon-prev,
.carousel-control .icon-next {
  width: 20px;
  height: 20px;
  line-height: 1;
  font-family: serif;
}
.carousel-control .icon-prev:before {
  content: '\2039';
}
.carousel-control .icon-next:before {
  content: '\203a';
}
.carousel-indicators {
  position: absolute;
  bottom: 10px;
  left: 50%;
  z-index: 15;
  width: 60%;
  margin-left: -30%;
  padding-left: 0;
  list-style: none;
  text-align: center;
}
.carousel-indicators li {
  display: inline-block;
  width: 10px;
  height: 10px;
  margin: 1px;
  text-indent: -999px;
  border: 1px solid #fff;
  border-radius: 10px;
  cursor: pointer;
  background-color: #000 \9;
  background-color: rgba(0, 0, 0, 0);
}
.carousel-indicators .active {
  margin: 0;
  width: 12px;
  height: 12px;
  background-color: #fff;
}
.carousel-caption {
  position: absolute;
  left: 15%;
  right: 15%;
  bottom: 20px;
  z-index: 10;
  padding-top: 20px;
  padding-bottom: 20px;
  color: #fff;
  text-align: center;
  text-shadow: 0 1px 2px rgba(0, 0, 0, 0.6);
}
.carousel-caption .btn {
  text-shadow: none;
}
@media screen and (min-width: 768px) {
  .carousel-control .glyphicon-chevron-left,
  .carousel-control .glyphicon-chevron-right,
  .carousel-control .icon-prev,
  .carousel-control .icon-next {
    width: 30px;
    height: 30px;
    margin-top: -10px;
    font-size: 30px;
  }
  .carousel-control .glyphicon-chevron-left,
  .carousel-control .icon-prev {
    margin-left: -10px;
  }
  .carousel-control .glyphicon-chevron-right,
  .carousel-control .icon-next {
    margin-right: -10px;
  }
  .carousel-caption {
    left: 20%;
    right: 20%;
    padding-bottom: 30px;
  }
  .carousel-indicators {
    bottom: 20px;
  }
}
.clearfix:before,
.clearfix:after,
.dl-horizontal dd:before,
.dl-horizontal dd:after,
.container:before,
.container:after,
.container-fluid:before,
.container-fluid:after,
.row:before,
.row:after,
.form-horizontal .form-group:before,
.form-horizontal .form-group:after,
.btn-toolbar:before,
.btn-toolbar:after,
.btn-group-vertical > .btn-group:before,
.btn-group-vertical > .btn-group:after,
.nav:before,
.nav:after,
.navbar:before,
.navbar:after,
.navbar-header:before,
.navbar-header:after,
.navbar-collapse:before,
.navbar-collapse:after,
.pager:before,
.pager:after,
.panel-body:before,
.panel-body:after,
.modal-header:before,
.modal-header:after,
.modal-footer:before,
.modal-footer:after,
.item_buttons:before,
.item_buttons:after {
  content: " ";
  display: table;
}
.clearfix:after,
.dl-horizontal dd:after,
.container:after,
.container-fluid:after,
.row:after,
.form-horizontal .form-group:after,
.btn-toolbar:after,
.btn-group-vertical > .btn-group:after,
.nav:after,
.navbar:after,
.navbar-header:after,
.navbar-collapse:after,
.pager:after,
.panel-body:after,
.modal-header:after,
.modal-footer:after,
.item_buttons:after {
  clear: both;
}
.center-block {
  display: block;
  margin-left: auto;
  margin-right: auto;
}
.pull-right {
  float: right !important;
}
.pull-left {
  float: left !important;
}
.hide {
  display: none !important;
}
.show {
  display: block !important;
}
.invisible {
  visibility: hidden;
}
.text-hide {
  font: 0/0 a;
  color: transparent;
  text-shadow: none;
  background-color: transparent;
  border: 0;
}
.hidden {
  display: none !important;
}
.affix {
  position: fixed;
}
@-ms-viewport {
  width: device-width;
}
.visible-xs,
.visible-sm,
.visible-md,
.visible-lg {
  display: none !important;
}
.visible-xs-block,
.visible-xs-inline,
.visible-xs-inline-block,
.visible-sm-block,
.visible-sm-inline,
.visible-sm-inline-block,
.visible-md-block,
.visible-md-inline,
.visible-md-inline-block,
.visible-lg-block,
.visible-lg-inline,
.visible-lg-inline-block {
  display: none !important;
}
@media (max-width: 767px) {
  .visible-xs {
    display: block !important;
  }
  table.visible-xs {
    display: table !important;
  }
  tr.visible-xs {
    display: table-row !important;
  }
  th.visible-xs,
  td.visible-xs {
    display: table-cell !important;
  }
}
@media (max-width: 767px) {
  .visible-xs-block {
    display: block !important;
  }
}
@media (max-width: 767px) {
  .visible-xs-inline {
    display: inline !important;
  }
}
@media (max-width: 767px) {
  .visible-xs-inline-block {
    display: inline-block !important;
  }
}
@media (min-width: 768px) and (max-width: 991px) {
  .visible-sm {
    display: block !important;
  }
  table.visible-sm {
    display: table !important;
  }
  tr.visible-sm {
    display: table-row !important;
  }
  th.visible-sm,
  td.visible-sm {
    display: table-cell !important;
  }
}
@media (min-width: 768px) and (max-width: 991px) {
  .visible-sm-block {
    display: block !important;
  }
}
@media (min-width: 768px) and (max-width: 991px) {
  .visible-sm-inline {
    display: inline !important;
  }
}
@media (min-width: 768px) and (max-width: 991px) {
  .visible-sm-inline-block {
    display: inline-block !important;
  }
}
@media (min-width: 992px) and (max-width: 1199px) {
  .visible-md {
    display: block !important;
  }
  table.visible-md {
    display: table !important;
  }
  tr.visible-md {
    display: table-row !important;
  }
  th.visible-md,
  td.visible-md {
    display: table-cell !important;
  }
}
@media (min-width: 992px) and (max-width: 1199px) {
  .visible-md-block {
    display: block !important;
  }
}
@media (min-width: 992px) and (max-width: 1199px) {
  .visible-md-inline {
    display: inline !important;
  }
}
@media (min-width: 992px) and (max-width: 1199px) {
  .visible-md-inline-block {
    display: inline-block !important;
  }
}
@media (min-width: 1200px) {
  .visible-lg {
    display: block !important;
  }
  table.visible-lg {
    display: table !important;
  }
  tr.visible-lg {
    display: table-row !important;
  }
  th.visible-lg,
  td.visible-lg {
    display: table-cell !important;
  }
}
@media (min-width: 1200px) {
  .visible-lg-block {
    display: block !important;
  }
}
@media (min-width: 1200px) {
  .visible-lg-inline {
    display: inline !important;
  }
}
@media (min-width: 1200px) {
  .visible-lg-inline-block {
    display: inline-block !important;
  }
}
@media (max-width: 767px) {
  .hidden-xs {
    display: none !important;
  }
}
@media (min-width: 768px) and (max-width: 991px) {
  .hidden-sm {
    display: none !important;
  }
}
@media (min-width: 992px) and (max-width: 1199px) {
  .hidden-md {
    display: none !important;
  }
}
@media (min-width: 1200px) {
  .hidden-lg {
    display: none !important;
  }
}
.visible-print {
  display: none !important;
}
@media print {
  .visible-print {
    display: block !important;
  }
  table.visible-print {
    display: table !important;
  }
  tr.visible-print {
    display: table-row !important;
  }
  th.visible-print,
  td.visible-print {
    display: table-cell !important;
  }
}
.visible-print-block {
  display: none !important;
}
@media print {
  .visible-print-block {
    display: block !important;
  }
}
.visible-print-inline {
  display: none !important;
}
@media print {
  .visible-print-inline {
    display: inline !important;
  }
}
.visible-print-inline-block {
  display: none !important;
}
@media print {
  .visible-print-inline-block {
    display: inline-block !important;
  }
}
@media print {
  .hidden-print {
    display: none !important;
  }
}
/*!
*
* Font Awesome
*
*/
/*!
 *  Font Awesome 4.2.0 by @davegandy - http://fontawesome.io - @fontawesome
 *  License - http://fontawesome.io/license (Font: SIL OFL 1.1, CSS: MIT License)
 */
/* FONT PATH
 * -------------------------- */
@font-face {
  font-family: 'FontAwesome';
  src: url('../components/font-awesome/fonts/fontawesome-webfont.eot?v=4.2.0');
  src: url('../components/font-awesome/fonts/fontawesome-webfont.eot?#iefix&v=4.2.0') format('embedded-opentype'), url('../components/font-awesome/fonts/fontawesome-webfont.woff?v=4.2.0') format('woff'), url('../components/font-awesome/fonts/fontawesome-webfont.ttf?v=4.2.0') format('truetype'), url('../components/font-awesome/fonts/fontawesome-webfont.svg?v=4.2.0#fontawesomeregular') format('svg');
  font-weight: normal;
  font-style: normal;
}
.fa {
  display: inline-block;
  font: normal normal normal 14px/1 FontAwesome;
  font-size: inherit;
  text-rendering: auto;
  -webkit-font-smoothing: antialiased;
  -moz-osx-font-smoothing: grayscale;
}
/* makes the font 33% larger relative to the icon container */
.fa-lg {
  font-size: 1.33333333em;
  line-height: 0.75em;
  vertical-align: -15%;
}
.fa-2x {
  font-size: 2em;
}
.fa-3x {
  font-size: 3em;
}
.fa-4x {
  font-size: 4em;
}
.fa-5x {
  font-size: 5em;
}
.fa-fw {
  width: 1.28571429em;
  text-align: center;
}
.fa-ul {
  padding-left: 0;
  margin-left: 2.14285714em;
  list-style-type: none;
}
.fa-ul > li {
  position: relative;
}
.fa-li {
  position: absolute;
  left: -2.14285714em;
  width: 2.14285714em;
  top: 0.14285714em;
  text-align: center;
}
.fa-li.fa-lg {
  left: -1.85714286em;
}
.fa-border {
  padding: .2em .25em .15em;
  border: solid 0.08em #eee;
  border-radius: .1em;
}
.pull-right {
  float: right;
}
.pull-left {
  float: left;
}
.fa.pull-left {
  margin-right: .3em;
}
.fa.pull-right {
  margin-left: .3em;
}
.fa-spin {
  -webkit-animation: fa-spin 2s infinite linear;
  animation: fa-spin 2s infinite linear;
}
@-webkit-keyframes fa-spin {
  0% {
    -webkit-transform: rotate(0deg);
    transform: rotate(0deg);
  }
  100% {
    -webkit-transform: rotate(359deg);
    transform: rotate(359deg);
  }
}
@keyframes fa-spin {
  0% {
    -webkit-transform: rotate(0deg);
    transform: rotate(0deg);
  }
  100% {
    -webkit-transform: rotate(359deg);
    transform: rotate(359deg);
  }
}
.fa-rotate-90 {
  filter: progid:DXImageTransform.Microsoft.BasicImage(rotation=1);
  -webkit-transform: rotate(90deg);
  -ms-transform: rotate(90deg);
  transform: rotate(90deg);
}
.fa-rotate-180 {
  filter: progid:DXImageTransform.Microsoft.BasicImage(rotation=2);
  -webkit-transform: rotate(180deg);
  -ms-transform: rotate(180deg);
  transform: rotate(180deg);
}
.fa-rotate-270 {
  filter: progid:DXImageTransform.Microsoft.BasicImage(rotation=3);
  -webkit-transform: rotate(270deg);
  -ms-transform: rotate(270deg);
  transform: rotate(270deg);
}
.fa-flip-horizontal {
  filter: progid:DXImageTransform.Microsoft.BasicImage(rotation=0, mirror=1);
  -webkit-transform: scale(-1, 1);
  -ms-transform: scale(-1, 1);
  transform: scale(-1, 1);
}
.fa-flip-vertical {
  filter: progid:DXImageTransform.Microsoft.BasicImage(rotation=2, mirror=1);
  -webkit-transform: scale(1, -1);
  -ms-transform: scale(1, -1);
  transform: scale(1, -1);
}
:root .fa-rotate-90,
:root .fa-rotate-180,
:root .fa-rotate-270,
:root .fa-flip-horizontal,
:root .fa-flip-vertical {
  filter: none;
}
.fa-stack {
  position: relative;
  display: inline-block;
  width: 2em;
  height: 2em;
  line-height: 2em;
  vertical-align: middle;
}
.fa-stack-1x,
.fa-stack-2x {
  position: absolute;
  left: 0;
  width: 100%;
  text-align: center;
}
.fa-stack-1x {
  line-height: inherit;
}
.fa-stack-2x {
  font-size: 2em;
}
.fa-inverse {
  color: #fff;
}
/* Font Awesome uses the Unicode Private Use Area (PUA) to ensure screen
   readers do not read off random characters that represent icons */
.fa-glass:before {
  content: "\f000";
}
.fa-music:before {
  content: "\f001";
}
.fa-search:before {
  content: "\f002";
}
.fa-envelope-o:before {
  content: "\f003";
}
.fa-heart:before {
  content: "\f004";
}
.fa-star:before {
  content: "\f005";
}
.fa-star-o:before {
  content: "\f006";
}
.fa-user:before {
  content: "\f007";
}
.fa-film:before {
  content: "\f008";
}
.fa-th-large:before {
  content: "\f009";
}
.fa-th:before {
  content: "\f00a";
}
.fa-th-list:before {
  content: "\f00b";
}
.fa-check:before {
  content: "\f00c";
}
.fa-remove:before,
.fa-close:before,
.fa-times:before {
  content: "\f00d";
}
.fa-search-plus:before {
  content: "\f00e";
}
.fa-search-minus:before {
  content: "\f010";
}
.fa-power-off:before {
  content: "\f011";
}
.fa-signal:before {
  content: "\f012";
}
.fa-gear:before,
.fa-cog:before {
  content: "\f013";
}
.fa-trash-o:before {
  content: "\f014";
}
.fa-home:before {
  content: "\f015";
}
.fa-file-o:before {
  content: "\f016";
}
.fa-clock-o:before {
  content: "\f017";
}
.fa-road:before {
  content: "\f018";
}
.fa-download:before {
  content: "\f019";
}
.fa-arrow-circle-o-down:before {
  content: "\f01a";
}
.fa-arrow-circle-o-up:before {
  content: "\f01b";
}
.fa-inbox:before {
  content: "\f01c";
}
.fa-play-circle-o:before {
  content: "\f01d";
}
.fa-rotate-right:before,
.fa-repeat:before {
  content: "\f01e";
}
.fa-refresh:before {
  content: "\f021";
}
.fa-list-alt:before {
  content: "\f022";
}
.fa-lock:before {
  content: "\f023";
}
.fa-flag:before {
  content: "\f024";
}
.fa-headphones:before {
  content: "\f025";
}
.fa-volume-off:before {
  content: "\f026";
}
.fa-volume-down:before {
  content: "\f027";
}
.fa-volume-up:before {
  content: "\f028";
}
.fa-qrcode:before {
  content: "\f029";
}
.fa-barcode:before {
  content: "\f02a";
}
.fa-tag:before {
  content: "\f02b";
}
.fa-tags:before {
  content: "\f02c";
}
.fa-book:before {
  content: "\f02d";
}
.fa-bookmark:before {
  content: "\f02e";
}
.fa-print:before {
  content: "\f02f";
}
.fa-camera:before {
  content: "\f030";
}
.fa-font:before {
  content: "\f031";
}
.fa-bold:before {
  content: "\f032";
}
.fa-italic:before {
  content: "\f033";
}
.fa-text-height:before {
  content: "\f034";
}
.fa-text-width:before {
  content: "\f035";
}
.fa-align-left:before {
  content: "\f036";
}
.fa-align-center:before {
  content: "\f037";
}
.fa-align-right:before {
  content: "\f038";
}
.fa-align-justify:before {
  content: "\f039";
}
.fa-list:before {
  content: "\f03a";
}
.fa-dedent:before,
.fa-outdent:before {
  content: "\f03b";
}
.fa-indent:before {
  content: "\f03c";
}
.fa-video-camera:before {
  content: "\f03d";
}
.fa-photo:before,
.fa-image:before,
.fa-picture-o:before {
  content: "\f03e";
}
.fa-pencil:before {
  content: "\f040";
}
.fa-map-marker:before {
  content: "\f041";
}
.fa-adjust:before {
  content: "\f042";
}
.fa-tint:before {
  content: "\f043";
}
.fa-edit:before,
.fa-pencil-square-o:before {
  content: "\f044";
}
.fa-share-square-o:before {
  content: "\f045";
}
.fa-check-square-o:before {
  content: "\f046";
}
.fa-arrows:before {
  content: "\f047";
}
.fa-step-backward:before {
  content: "\f048";
}
.fa-fast-backward:before {
  content: "\f049";
}
.fa-backward:before {
  content: "\f04a";
}
.fa-play:before {
  content: "\f04b";
}
.fa-pause:before {
  content: "\f04c";
}
.fa-stop:before {
  content: "\f04d";
}
.fa-forward:before {
  content: "\f04e";
}
.fa-fast-forward:before {
  content: "\f050";
}
.fa-step-forward:before {
  content: "\f051";
}
.fa-eject:before {
  content: "\f052";
}
.fa-chevron-left:before {
  content: "\f053";
}
.fa-chevron-right:before {
  content: "\f054";
}
.fa-plus-circle:before {
  content: "\f055";
}
.fa-minus-circle:before {
  content: "\f056";
}
.fa-times-circle:before {
  content: "\f057";
}
.fa-check-circle:before {
  content: "\f058";
}
.fa-question-circle:before {
  content: "\f059";
}
.fa-info-circle:before {
  content: "\f05a";
}
.fa-crosshairs:before {
  content: "\f05b";
}
.fa-times-circle-o:before {
  content: "\f05c";
}
.fa-check-circle-o:before {
  content: "\f05d";
}
.fa-ban:before {
  content: "\f05e";
}
.fa-arrow-left:before {
  content: "\f060";
}
.fa-arrow-right:before {
  content: "\f061";
}
.fa-arrow-up:before {
  content: "\f062";
}
.fa-arrow-down:before {
  content: "\f063";
}
.fa-mail-forward:before,
.fa-share:before {
  content: "\f064";
}
.fa-expand:before {
  content: "\f065";
}
.fa-compress:before {
  content: "\f066";
}
.fa-plus:before {
  content: "\f067";
}
.fa-minus:before {
  content: "\f068";
}
.fa-asterisk:before {
  content: "\f069";
}
.fa-exclamation-circle:before {
  content: "\f06a";
}
.fa-gift:before {
  content: "\f06b";
}
.fa-leaf:before {
  content: "\f06c";
}
.fa-fire:before {
  content: "\f06d";
}
.fa-eye:before {
  content: "\f06e";
}
.fa-eye-slash:before {
  content: "\f070";
}
.fa-warning:before,
.fa-exclamation-triangle:before {
  content: "\f071";
}
.fa-plane:before {
  content: "\f072";
}
.fa-calendar:before {
  content: "\f073";
}
.fa-random:before {
  content: "\f074";
}
.fa-comment:before {
  content: "\f075";
}
.fa-magnet:before {
  content: "\f076";
}
.fa-chevron-up:before {
  content: "\f077";
}
.fa-chevron-down:before {
  content: "\f078";
}
.fa-retweet:before {
  content: "\f079";
}
.fa-shopping-cart:before {
  content: "\f07a";
}
.fa-folder:before {
  content: "\f07b";
}
.fa-folder-open:before {
  content: "\f07c";
}
.fa-arrows-v:before {
  content: "\f07d";
}
.fa-arrows-h:before {
  content: "\f07e";
}
.fa-bar-chart-o:before,
.fa-bar-chart:before {
  content: "\f080";
}
.fa-twitter-square:before {
  content: "\f081";
}
.fa-facebook-square:before {
  content: "\f082";
}
.fa-camera-retro:before {
  content: "\f083";
}
.fa-key:before {
  content: "\f084";
}
.fa-gears:before,
.fa-cogs:before {
  content: "\f085";
}
.fa-comments:before {
  content: "\f086";
}
.fa-thumbs-o-up:before {
  content: "\f087";
}
.fa-thumbs-o-down:before {
  content: "\f088";
}
.fa-star-half:before {
  content: "\f089";
}
.fa-heart-o:before {
  content: "\f08a";
}
.fa-sign-out:before {
  content: "\f08b";
}
.fa-linkedin-square:before {
  content: "\f08c";
}
.fa-thumb-tack:before {
  content: "\f08d";
}
.fa-external-link:before {
  content: "\f08e";
}
.fa-sign-in:before {
  content: "\f090";
}
.fa-trophy:before {
  content: "\f091";
}
.fa-github-square:before {
  content: "\f092";
}
.fa-upload:before {
  content: "\f093";
}
.fa-lemon-o:before {
  content: "\f094";
}
.fa-phone:before {
  content: "\f095";
}
.fa-square-o:before {
  content: "\f096";
}
.fa-bookmark-o:before {
  content: "\f097";
}
.fa-phone-square:before {
  content: "\f098";
}
.fa-twitter:before {
  content: "\f099";
}
.fa-facebook:before {
  content: "\f09a";
}
.fa-github:before {
  content: "\f09b";
}
.fa-unlock:before {
  content: "\f09c";
}
.fa-credit-card:before {
  content: "\f09d";
}
.fa-rss:before {
  content: "\f09e";
}
.fa-hdd-o:before {
  content: "\f0a0";
}
.fa-bullhorn:before {
  content: "\f0a1";
}
.fa-bell:before {
  content: "\f0f3";
}
.fa-certificate:before {
  content: "\f0a3";
}
.fa-hand-o-right:before {
  content: "\f0a4";
}
.fa-hand-o-left:before {
  content: "\f0a5";
}
.fa-hand-o-up:before {
  content: "\f0a6";
}
.fa-hand-o-down:before {
  content: "\f0a7";
}
.fa-arrow-circle-left:before {
  content: "\f0a8";
}
.fa-arrow-circle-right:before {
  content: "\f0a9";
}
.fa-arrow-circle-up:before {
  content: "\f0aa";
}
.fa-arrow-circle-down:before {
  content: "\f0ab";
}
.fa-globe:before {
  content: "\f0ac";
}
.fa-wrench:before {
  content: "\f0ad";
}
.fa-tasks:before {
  content: "\f0ae";
}
.fa-filter:before {
  content: "\f0b0";
}
.fa-briefcase:before {
  content: "\f0b1";
}
.fa-arrows-alt:before {
  content: "\f0b2";
}
.fa-group:before,
.fa-users:before {
  content: "\f0c0";
}
.fa-chain:before,
.fa-link:before {
  content: "\f0c1";
}
.fa-cloud:before {
  content: "\f0c2";
}
.fa-flask:before {
  content: "\f0c3";
}
.fa-cut:before,
.fa-scissors:before {
  content: "\f0c4";
}
.fa-copy:before,
.fa-files-o:before {
  content: "\f0c5";
}
.fa-paperclip:before {
  content: "\f0c6";
}
.fa-save:before,
.fa-floppy-o:before {
  content: "\f0c7";
}
.fa-square:before {
  content: "\f0c8";
}
.fa-navicon:before,
.fa-reorder:before,
.fa-bars:before {
  content: "\f0c9";
}
.fa-list-ul:before {
  content: "\f0ca";
}
.fa-list-ol:before {
  content: "\f0cb";
}
.fa-strikethrough:before {
  content: "\f0cc";
}
.fa-underline:before {
  content: "\f0cd";
}
.fa-table:before {
  content: "\f0ce";
}
.fa-magic:before {
  content: "\f0d0";
}
.fa-truck:before {
  content: "\f0d1";
}
.fa-pinterest:before {
  content: "\f0d2";
}
.fa-pinterest-square:before {
  content: "\f0d3";
}
.fa-google-plus-square:before {
  content: "\f0d4";
}
.fa-google-plus:before {
  content: "\f0d5";
}
.fa-money:before {
  content: "\f0d6";
}
.fa-caret-down:before {
  content: "\f0d7";
}
.fa-caret-up:before {
  content: "\f0d8";
}
.fa-caret-left:before {
  content: "\f0d9";
}
.fa-caret-right:before {
  content: "\f0da";
}
.fa-columns:before {
  content: "\f0db";
}
.fa-unsorted:before,
.fa-sort:before {
  content: "\f0dc";
}
.fa-sort-down:before,
.fa-sort-desc:before {
  content: "\f0dd";
}
.fa-sort-up:before,
.fa-sort-asc:before {
  content: "\f0de";
}
.fa-envelope:before {
  content: "\f0e0";
}
.fa-linkedin:before {
  content: "\f0e1";
}
.fa-rotate-left:before,
.fa-undo:before {
  content: "\f0e2";
}
.fa-legal:before,
.fa-gavel:before {
  content: "\f0e3";
}
.fa-dashboard:before,
.fa-tachometer:before {
  content: "\f0e4";
}
.fa-comment-o:before {
  content: "\f0e5";
}
.fa-comments-o:before {
  content: "\f0e6";
}
.fa-flash:before,
.fa-bolt:before {
  content: "\f0e7";
}
.fa-sitemap:before {
  content: "\f0e8";
}
.fa-umbrella:before {
  content: "\f0e9";
}
.fa-paste:before,
.fa-clipboard:before {
  content: "\f0ea";
}
.fa-lightbulb-o:before {
  content: "\f0eb";
}
.fa-exchange:before {
  content: "\f0ec";
}
.fa-cloud-download:before {
  content: "\f0ed";
}
.fa-cloud-upload:before {
  content: "\f0ee";
}
.fa-user-md:before {
  content: "\f0f0";
}
.fa-stethoscope:before {
  content: "\f0f1";
}
.fa-suitcase:before {
  content: "\f0f2";
}
.fa-bell-o:before {
  content: "\f0a2";
}
.fa-coffee:before {
  content: "\f0f4";
}
.fa-cutlery:before {
  content: "\f0f5";
}
.fa-file-text-o:before {
  content: "\f0f6";
}
.fa-building-o:before {
  content: "\f0f7";
}
.fa-hospital-o:before {
  content: "\f0f8";
}
.fa-ambulance:before {
  content: "\f0f9";
}
.fa-medkit:before {
  content: "\f0fa";
}
.fa-fighter-jet:before {
  content: "\f0fb";
}
.fa-beer:before {
  content: "\f0fc";
}
.fa-h-square:before {
  content: "\f0fd";
}
.fa-plus-square:before {
  content: "\f0fe";
}
.fa-angle-double-left:before {
  content: "\f100";
}
.fa-angle-double-right:before {
  content: "\f101";
}
.fa-angle-double-up:before {
  content: "\f102";
}
.fa-angle-double-down:before {
  content: "\f103";
}
.fa-angle-left:before {
  content: "\f104";
}
.fa-angle-right:before {
  content: "\f105";
}
.fa-angle-up:before {
  content: "\f106";
}
.fa-angle-down:before {
  content: "\f107";
}
.fa-desktop:before {
  content: "\f108";
}
.fa-laptop:before {
  content: "\f109";
}
.fa-tablet:before {
  content: "\f10a";
}
.fa-mobile-phone:before,
.fa-mobile:before {
  content: "\f10b";
}
.fa-circle-o:before {
  content: "\f10c";
}
.fa-quote-left:before {
  content: "\f10d";
}
.fa-quote-right:before {
  content: "\f10e";
}
.fa-spinner:before {
  content: "\f110";
}
.fa-circle:before {
  content: "\f111";
}
.fa-mail-reply:before,
.fa-reply:before {
  content: "\f112";
}
.fa-github-alt:before {
  content: "\f113";
}
.fa-folder-o:before {
  content: "\f114";
}
.fa-folder-open-o:before {
  content: "\f115";
}
.fa-smile-o:before {
  content: "\f118";
}
.fa-frown-o:before {
  content: "\f119";
}
.fa-meh-o:before {
  content: "\f11a";
}
.fa-gamepad:before {
  content: "\f11b";
}
.fa-keyboard-o:before {
  content: "\f11c";
}
.fa-flag-o:before {
  content: "\f11d";
}
.fa-flag-checkered:before {
  content: "\f11e";
}
.fa-terminal:before {
  content: "\f120";
}
.fa-code:before {
  content: "\f121";
}
.fa-mail-reply-all:before,
.fa-reply-all:before {
  content: "\f122";
}
.fa-star-half-empty:before,
.fa-star-half-full:before,
.fa-star-half-o:before {
  content: "\f123";
}
.fa-location-arrow:before {
  content: "\f124";
}
.fa-crop:before {
  content: "\f125";
}
.fa-code-fork:before {
  content: "\f126";
}
.fa-unlink:before,
.fa-chain-broken:before {
  content: "\f127";
}
.fa-question:before {
  content: "\f128";
}
.fa-info:before {
  content: "\f129";
}
.fa-exclamation:before {
  content: "\f12a";
}
.fa-superscript:before {
  content: "\f12b";
}
.fa-subscript:before {
  content: "\f12c";
}
.fa-eraser:before {
  content: "\f12d";
}
.fa-puzzle-piece:before {
  content: "\f12e";
}
.fa-microphone:before {
  content: "\f130";
}
.fa-microphone-slash:before {
  content: "\f131";
}
.fa-shield:before {
  content: "\f132";
}
.fa-calendar-o:before {
  content: "\f133";
}
.fa-fire-extinguisher:before {
  content: "\f134";
}
.fa-rocket:before {
  content: "\f135";
}
.fa-maxcdn:before {
  content: "\f136";
}
.fa-chevron-circle-left:before {
  content: "\f137";
}
.fa-chevron-circle-right:before {
  content: "\f138";
}
.fa-chevron-circle-up:before {
  content: "\f139";
}
.fa-chevron-circle-down:before {
  content: "\f13a";
}
.fa-html5:before {
  content: "\f13b";
}
.fa-css3:before {
  content: "\f13c";
}
.fa-anchor:before {
  content: "\f13d";
}
.fa-unlock-alt:before {
  content: "\f13e";
}
.fa-bullseye:before {
  content: "\f140";
}
.fa-ellipsis-h:before {
  content: "\f141";
}
.fa-ellipsis-v:before {
  content: "\f142";
}
.fa-rss-square:before {
  content: "\f143";
}
.fa-play-circle:before {
  content: "\f144";
}
.fa-ticket:before {
  content: "\f145";
}
.fa-minus-square:before {
  content: "\f146";
}
.fa-minus-square-o:before {
  content: "\f147";
}
.fa-level-up:before {
  content: "\f148";
}
.fa-level-down:before {
  content: "\f149";
}
.fa-check-square:before {
  content: "\f14a";
}
.fa-pencil-square:before {
  content: "\f14b";
}
.fa-external-link-square:before {
  content: "\f14c";
}
.fa-share-square:before {
  content: "\f14d";
}
.fa-compass:before {
  content: "\f14e";
}
.fa-toggle-down:before,
.fa-caret-square-o-down:before {
  content: "\f150";
}
.fa-toggle-up:before,
.fa-caret-square-o-up:before {
  content: "\f151";
}
.fa-toggle-right:before,
.fa-caret-square-o-right:before {
  content: "\f152";
}
.fa-euro:before,
.fa-eur:before {
  content: "\f153";
}
.fa-gbp:before {
  content: "\f154";
}
.fa-dollar:before,
.fa-usd:before {
  content: "\f155";
}
.fa-rupee:before,
.fa-inr:before {
  content: "\f156";
}
.fa-cny:before,
.fa-rmb:before,
.fa-yen:before,
.fa-jpy:before {
  content: "\f157";
}
.fa-ruble:before,
.fa-rouble:before,
.fa-rub:before {
  content: "\f158";
}
.fa-won:before,
.fa-krw:before {
  content: "\f159";
}
.fa-bitcoin:before,
.fa-btc:before {
  content: "\f15a";
}
.fa-file:before {
  content: "\f15b";
}
.fa-file-text:before {
  content: "\f15c";
}
.fa-sort-alpha-asc:before {
  content: "\f15d";
}
.fa-sort-alpha-desc:before {
  content: "\f15e";
}
.fa-sort-amount-asc:before {
  content: "\f160";
}
.fa-sort-amount-desc:before {
  content: "\f161";
}
.fa-sort-numeric-asc:before {
  content: "\f162";
}
.fa-sort-numeric-desc:before {
  content: "\f163";
}
.fa-thumbs-up:before {
  content: "\f164";
}
.fa-thumbs-down:before {
  content: "\f165";
}
.fa-youtube-square:before {
  content: "\f166";
}
.fa-youtube:before {
  content: "\f167";
}
.fa-xing:before {
  content: "\f168";
}
.fa-xing-square:before {
  content: "\f169";
}
.fa-youtube-play:before {
  content: "\f16a";
}
.fa-dropbox:before {
  content: "\f16b";
}
.fa-stack-overflow:before {
  content: "\f16c";
}
.fa-instagram:before {
  content: "\f16d";
}
.fa-flickr:before {
  content: "\f16e";
}
.fa-adn:before {
  content: "\f170";
}
.fa-bitbucket:before {
  content: "\f171";
}
.fa-bitbucket-square:before {
  content: "\f172";
}
.fa-tumblr:before {
  content: "\f173";
}
.fa-tumblr-square:before {
  content: "\f174";
}
.fa-long-arrow-down:before {
  content: "\f175";
}
.fa-long-arrow-up:before {
  content: "\f176";
}
.fa-long-arrow-left:before {
  content: "\f177";
}
.fa-long-arrow-right:before {
  content: "\f178";
}
.fa-apple:before {
  content: "\f179";
}
.fa-windows:before {
  content: "\f17a";
}
.fa-android:before {
  content: "\f17b";
}
.fa-linux:before {
  content: "\f17c";
}
.fa-dribbble:before {
  content: "\f17d";
}
.fa-skype:before {
  content: "\f17e";
}
.fa-foursquare:before {
  content: "\f180";
}
.fa-trello:before {
  content: "\f181";
}
.fa-female:before {
  content: "\f182";
}
.fa-male:before {
  content: "\f183";
}
.fa-gittip:before {
  content: "\f184";
}
.fa-sun-o:before {
  content: "\f185";
}
.fa-moon-o:before {
  content: "\f186";
}
.fa-archive:before {
  content: "\f187";
}
.fa-bug:before {
  content: "\f188";
}
.fa-vk:before {
  content: "\f189";
}
.fa-weibo:before {
  content: "\f18a";
}
.fa-renren:before {
  content: "\f18b";
}
.fa-pagelines:before {
  content: "\f18c";
}
.fa-stack-exchange:before {
  content: "\f18d";
}
.fa-arrow-circle-o-right:before {
  content: "\f18e";
}
.fa-arrow-circle-o-left:before {
  content: "\f190";
}
.fa-toggle-left:before,
.fa-caret-square-o-left:before {
  content: "\f191";
}
.fa-dot-circle-o:before {
  content: "\f192";
}
.fa-wheelchair:before {
  content: "\f193";
}
.fa-vimeo-square:before {
  content: "\f194";
}
.fa-turkish-lira:before,
.fa-try:before {
  content: "\f195";
}
.fa-plus-square-o:before {
  content: "\f196";
}
.fa-space-shuttle:before {
  content: "\f197";
}
.fa-slack:before {
  content: "\f198";
}
.fa-envelope-square:before {
  content: "\f199";
}
.fa-wordpress:before {
  content: "\f19a";
}
.fa-openid:before {
  content: "\f19b";
}
.fa-institution:before,
.fa-bank:before,
.fa-university:before {
  content: "\f19c";
}
.fa-mortar-board:before,
.fa-graduation-cap:before {
  content: "\f19d";
}
.fa-yahoo:before {
  content: "\f19e";
}
.fa-google:before {
  content: "\f1a0";
}
.fa-reddit:before {
  content: "\f1a1";
}
.fa-reddit-square:before {
  content: "\f1a2";
}
.fa-stumbleupon-circle:before {
  content: "\f1a3";
}
.fa-stumbleupon:before {
  content: "\f1a4";
}
.fa-delicious:before {
  content: "\f1a5";
}
.fa-digg:before {
  content: "\f1a6";
}
.fa-pied-piper:before {
  content: "\f1a7";
}
.fa-pied-piper-alt:before {
  content: "\f1a8";
}
.fa-drupal:before {
  content: "\f1a9";
}
.fa-joomla:before {
  content: "\f1aa";
}
.fa-language:before {
  content: "\f1ab";
}
.fa-fax:before {
  content: "\f1ac";
}
.fa-building:before {
  content: "\f1ad";
}
.fa-child:before {
  content: "\f1ae";
}
.fa-paw:before {
  content: "\f1b0";
}
.fa-spoon:before {
  content: "\f1b1";
}
.fa-cube:before {
  content: "\f1b2";
}
.fa-cubes:before {
  content: "\f1b3";
}
.fa-behance:before {
  content: "\f1b4";
}
.fa-behance-square:before {
  content: "\f1b5";
}
.fa-steam:before {
  content: "\f1b6";
}
.fa-steam-square:before {
  content: "\f1b7";
}
.fa-recycle:before {
  content: "\f1b8";
}
.fa-automobile:before,
.fa-car:before {
  content: "\f1b9";
}
.fa-cab:before,
.fa-taxi:before {
  content: "\f1ba";
}
.fa-tree:before {
  content: "\f1bb";
}
.fa-spotify:before {
  content: "\f1bc";
}
.fa-deviantart:before {
  content: "\f1bd";
}
.fa-soundcloud:before {
  content: "\f1be";
}
.fa-database:before {
  content: "\f1c0";
}
.fa-file-pdf-o:before {
  content: "\f1c1";
}
.fa-file-word-o:before {
  content: "\f1c2";
}
.fa-file-excel-o:before {
  content: "\f1c3";
}
.fa-file-powerpoint-o:before {
  content: "\f1c4";
}
.fa-file-photo-o:before,
.fa-file-picture-o:before,
.fa-file-image-o:before {
  content: "\f1c5";
}
.fa-file-zip-o:before,
.fa-file-archive-o:before {
  content: "\f1c6";
}
.fa-file-sound-o:before,
.fa-file-audio-o:before {
  content: "\f1c7";
}
.fa-file-movie-o:before,
.fa-file-video-o:before {
  content: "\f1c8";
}
.fa-file-code-o:before {
  content: "\f1c9";
}
.fa-vine:before {
  content: "\f1ca";
}
.fa-codepen:before {
  content: "\f1cb";
}
.fa-jsfiddle:before {
  content: "\f1cc";
}
.fa-life-bouy:before,
.fa-life-buoy:before,
.fa-life-saver:before,
.fa-support:before,
.fa-life-ring:before {
  content: "\f1cd";
}
.fa-circle-o-notch:before {
  content: "\f1ce";
}
.fa-ra:before,
.fa-rebel:before {
  content: "\f1d0";
}
.fa-ge:before,
.fa-empire:before {
  content: "\f1d1";
}
.fa-git-square:before {
  content: "\f1d2";
}
.fa-git:before {
  content: "\f1d3";
}
.fa-hacker-news:before {
  content: "\f1d4";
}
.fa-tencent-weibo:before {
  content: "\f1d5";
}
.fa-qq:before {
  content: "\f1d6";
}
.fa-wechat:before,
.fa-weixin:before {
  content: "\f1d7";
}
.fa-send:before,
.fa-paper-plane:before {
  content: "\f1d8";
}
.fa-send-o:before,
.fa-paper-plane-o:before {
  content: "\f1d9";
}
.fa-history:before {
  content: "\f1da";
}
.fa-circle-thin:before {
  content: "\f1db";
}
.fa-header:before {
  content: "\f1dc";
}
.fa-paragraph:before {
  content: "\f1dd";
}
.fa-sliders:before {
  content: "\f1de";
}
.fa-share-alt:before {
  content: "\f1e0";
}
.fa-share-alt-square:before {
  content: "\f1e1";
}
.fa-bomb:before {
  content: "\f1e2";
}
.fa-soccer-ball-o:before,
.fa-futbol-o:before {
  content: "\f1e3";
}
.fa-tty:before {
  content: "\f1e4";
}
.fa-binoculars:before {
  content: "\f1e5";
}
.fa-plug:before {
  content: "\f1e6";
}
.fa-slideshare:before {
  content: "\f1e7";
}
.fa-twitch:before {
  content: "\f1e8";
}
.fa-yelp:before {
  content: "\f1e9";
}
.fa-newspaper-o:before {
  content: "\f1ea";
}
.fa-wifi:before {
  content: "\f1eb";
}
.fa-calculator:before {
  content: "\f1ec";
}
.fa-paypal:before {
  content: "\f1ed";
}
.fa-google-wallet:before {
  content: "\f1ee";
}
.fa-cc-visa:before {
  content: "\f1f0";
}
.fa-cc-mastercard:before {
  content: "\f1f1";
}
.fa-cc-discover:before {
  content: "\f1f2";
}
.fa-cc-amex:before {
  content: "\f1f3";
}
.fa-cc-paypal:before {
  content: "\f1f4";
}
.fa-cc-stripe:before {
  content: "\f1f5";
}
.fa-bell-slash:before {
  content: "\f1f6";
}
.fa-bell-slash-o:before {
  content: "\f1f7";
}
.fa-trash:before {
  content: "\f1f8";
}
.fa-copyright:before {
  content: "\f1f9";
}
.fa-at:before {
  content: "\f1fa";
}
.fa-eyedropper:before {
  content: "\f1fb";
}
.fa-paint-brush:before {
  content: "\f1fc";
}
.fa-birthday-cake:before {
  content: "\f1fd";
}
.fa-area-chart:before {
  content: "\f1fe";
}
.fa-pie-chart:before {
  content: "\f200";
}
.fa-line-chart:before {
  content: "\f201";
}
.fa-lastfm:before {
  content: "\f202";
}
.fa-lastfm-square:before {
  content: "\f203";
}
.fa-toggle-off:before {
  content: "\f204";
}
.fa-toggle-on:before {
  content: "\f205";
}
.fa-bicycle:before {
  content: "\f206";
}
.fa-bus:before {
  content: "\f207";
}
.fa-ioxhost:before {
  content: "\f208";
}
.fa-angellist:before {
  content: "\f209";
}
.fa-cc:before {
  content: "\f20a";
}
.fa-shekel:before,
.fa-sheqel:before,
.fa-ils:before {
  content: "\f20b";
}
.fa-meanpath:before {
  content: "\f20c";
}
/*!
*
* IPython base
*
*/
.modal.fade .modal-dialog {
  -webkit-transform: translate(0, 0);
  -ms-transform: translate(0, 0);
  -o-transform: translate(0, 0);
  transform: translate(0, 0);
}
code {
  color: #000;
}
pre {
  font-size: inherit;
  line-height: inherit;
}
label {
  font-weight: normal;
}
/* Make the page background atleast 100% the height of the view port */
/* Make the page itself atleast 70% the height of the view port */
.border-box-sizing {
  box-sizing: border-box;
  -moz-box-sizing: border-box;
  -webkit-box-sizing: border-box;
}
.corner-all {
  border-radius: 2px;
}
.no-padding {
  padding: 0px;
}
/* Flexible box model classes */
/* Taken from Alex Russell http://infrequently.org/2009/08/css-3-progress/ */
/* This file is a compatability layer.  It allows the usage of flexible box 
model layouts accross multiple browsers, including older browsers.  The newest,
universal implementation of the flexible box model is used when available (see
`Modern browsers` comments below).  Browsers that are known to implement this 
new spec completely include:

    Firefox 28.0+
    Chrome 29.0+
    Internet Explorer 11+ 
    Opera 17.0+

Browsers not listed, including Safari, are supported via the styling under the
`Old browsers` comments below.
*/
.hbox {
  /* Old browsers */
  display: -webkit-box;
  -webkit-box-orient: horizontal;
  -webkit-box-align: stretch;
  display: -moz-box;
  -moz-box-orient: horizontal;
  -moz-box-align: stretch;
  display: box;
  box-orient: horizontal;
  box-align: stretch;
  /* Modern browsers */
  display: flex;
  flex-direction: row;
  align-items: stretch;
}
.hbox > * {
  /* Old browsers */
  -webkit-box-flex: 0;
  -moz-box-flex: 0;
  box-flex: 0;
  /* Modern browsers */
  flex: none;
}
.vbox {
  /* Old browsers */
  display: -webkit-box;
  -webkit-box-orient: vertical;
  -webkit-box-align: stretch;
  display: -moz-box;
  -moz-box-orient: vertical;
  -moz-box-align: stretch;
  display: box;
  box-orient: vertical;
  box-align: stretch;
  /* Modern browsers */
  display: flex;
  flex-direction: column;
  align-items: stretch;
}
.vbox > * {
  /* Old browsers */
  -webkit-box-flex: 0;
  -moz-box-flex: 0;
  box-flex: 0;
  /* Modern browsers */
  flex: none;
}
.hbox.reverse,
.vbox.reverse,
.reverse {
  /* Old browsers */
  -webkit-box-direction: reverse;
  -moz-box-direction: reverse;
  box-direction: reverse;
  /* Modern browsers */
  flex-direction: row-reverse;
}
.hbox.box-flex0,
.vbox.box-flex0,
.box-flex0 {
  /* Old browsers */
  -webkit-box-flex: 0;
  -moz-box-flex: 0;
  box-flex: 0;
  /* Modern browsers */
  flex: none;
  width: auto;
}
.hbox.box-flex1,
.vbox.box-flex1,
.box-flex1 {
  /* Old browsers */
  -webkit-box-flex: 1;
  -moz-box-flex: 1;
  box-flex: 1;
  /* Modern browsers */
  flex: 1;
}
.hbox.box-flex,
.vbox.box-flex,
.box-flex {
  /* Old browsers */
  /* Old browsers */
  -webkit-box-flex: 1;
  -moz-box-flex: 1;
  box-flex: 1;
  /* Modern browsers */
  flex: 1;
}
.hbox.box-flex2,
.vbox.box-flex2,
.box-flex2 {
  /* Old browsers */
  -webkit-box-flex: 2;
  -moz-box-flex: 2;
  box-flex: 2;
  /* Modern browsers */
  flex: 2;
}
.box-group1 {
  /*  Deprecated */
  -webkit-box-flex-group: 1;
  -moz-box-flex-group: 1;
  box-flex-group: 1;
}
.box-group2 {
  /* Deprecated */
  -webkit-box-flex-group: 2;
  -moz-box-flex-group: 2;
  box-flex-group: 2;
}
.hbox.start,
.vbox.start,
.start {
  /* Old browsers */
  -webkit-box-pack: start;
  -moz-box-pack: start;
  box-pack: start;
  /* Modern browsers */
  justify-content: flex-start;
}
.hbox.end,
.vbox.end,
.end {
  /* Old browsers */
  -webkit-box-pack: end;
  -moz-box-pack: end;
  box-pack: end;
  /* Modern browsers */
  justify-content: flex-end;
}
.hbox.center,
.vbox.center,
.center {
  /* Old browsers */
  -webkit-box-pack: center;
  -moz-box-pack: center;
  box-pack: center;
  /* Modern browsers */
  justify-content: center;
}
.hbox.baseline,
.vbox.baseline,
.baseline {
  /* Old browsers */
  -webkit-box-pack: baseline;
  -moz-box-pack: baseline;
  box-pack: baseline;
  /* Modern browsers */
  justify-content: baseline;
}
.hbox.stretch,
.vbox.stretch,
.stretch {
  /* Old browsers */
  -webkit-box-pack: stretch;
  -moz-box-pack: stretch;
  box-pack: stretch;
  /* Modern browsers */
  justify-content: stretch;
}
.hbox.align-start,
.vbox.align-start,
.align-start {
  /* Old browsers */
  -webkit-box-align: start;
  -moz-box-align: start;
  box-align: start;
  /* Modern browsers */
  align-items: flex-start;
}
.hbox.align-end,
.vbox.align-end,
.align-end {
  /* Old browsers */
  -webkit-box-align: end;
  -moz-box-align: end;
  box-align: end;
  /* Modern browsers */
  align-items: flex-end;
}
.hbox.align-center,
.vbox.align-center,
.align-center {
  /* Old browsers */
  -webkit-box-align: center;
  -moz-box-align: center;
  box-align: center;
  /* Modern browsers */
  align-items: center;
}
.hbox.align-baseline,
.vbox.align-baseline,
.align-baseline {
  /* Old browsers */
  -webkit-box-align: baseline;
  -moz-box-align: baseline;
  box-align: baseline;
  /* Modern browsers */
  align-items: baseline;
}
.hbox.align-stretch,
.vbox.align-stretch,
.align-stretch {
  /* Old browsers */
  -webkit-box-align: stretch;
  -moz-box-align: stretch;
  box-align: stretch;
  /* Modern browsers */
  align-items: stretch;
}
div.error {
  margin: 2em;
  text-align: center;
}
div.error > h1 {
  font-size: 500%;
  line-height: normal;
}
div.error > p {
  font-size: 200%;
  line-height: normal;
}
div.traceback-wrapper {
  text-align: left;
  max-width: 800px;
  margin: auto;
}
/**
 * Primary styles
 *
 * Author: Jupyter Development Team
 */
body {
  background-color: #fff;
  /* This makes sure that the body covers the entire window and needs to
       be in a different element than the display: box in wrapper below */
  position: absolute;
  left: 0px;
  right: 0px;
  top: 0px;
  bottom: 0px;
  overflow: visible;
}
body > #header {
  /* Initially hidden to prevent FLOUC */
  display: none;
  background-color: #fff;
  /* Display over codemirror */
  position: relative;
  z-index: 100;
}
body > #header #header-container {
  padding-bottom: 5px;
  padding-top: 5px;
  box-sizing: border-box;
  -moz-box-sizing: border-box;
  -webkit-box-sizing: border-box;
}
body > #header .header-bar {
  width: 100%;
  height: 1px;
  background: #e7e7e7;
  margin-bottom: -1px;
}
@media print {
  body > #header {
    display: none !important;
  }
}
#header-spacer {
  width: 100%;
  visibility: hidden;
}
@media print {
  #header-spacer {
    display: none;
  }
}
#ipython_notebook {
  padding-left: 0px;
  padding-top: 1px;
  padding-bottom: 1px;
}
@media (max-width: 991px) {
  #ipython_notebook {
    margin-left: 10px;
  }
}
#noscript {
  width: auto;
  padding-top: 16px;
  padding-bottom: 16px;
  text-align: center;
  font-size: 22px;
  color: red;
  font-weight: bold;
}
#ipython_notebook img {
  height: 28px;
}
#site {
  width: 100%;
  display: none;
  box-sizing: border-box;
  -moz-box-sizing: border-box;
  -webkit-box-sizing: border-box;
  overflow: auto;
}
@media print {
  #site {
    height: auto !important;
  }
}
/* Smaller buttons */
.ui-button .ui-button-text {
  padding: 0.2em 0.8em;
  font-size: 77%;
}
input.ui-button {
  padding: 0.3em 0.9em;
}
span#login_widget {
  float: right;
}
span#login_widget > .button,
#logout {
  color: #333;
  background-color: #fff;
  border-color: #ccc;
}
span#login_widget > .button:focus,
#logout:focus,
span#login_widget > .button.focus,
#logout.focus {
  color: #333;
  background-color: #e6e6e6;
  border-color: #8c8c8c;
}
span#login_widget > .button:hover,
#logout:hover {
  color: #333;
  background-color: #e6e6e6;
  border-color: #adadad;
}
span#login_widget > .button:active,
#logout:active,
span#login_widget > .button.active,
#logout.active,
.open > .dropdown-togglespan#login_widget > .button,
.open > .dropdown-toggle#logout {
  color: #333;
  background-color: #e6e6e6;
  border-color: #adadad;
}
span#login_widget > .button:active:hover,
#logout:active:hover,
span#login_widget > .button.active:hover,
#logout.active:hover,
.open > .dropdown-togglespan#login_widget > .button:hover,
.open > .dropdown-toggle#logout:hover,
span#login_widget > .button:active:focus,
#logout:active:focus,
span#login_widget > .button.active:focus,
#logout.active:focus,
.open > .dropdown-togglespan#login_widget > .button:focus,
.open > .dropdown-toggle#logout:focus,
span#login_widget > .button:active.focus,
#logout:active.focus,
span#login_widget > .button.active.focus,
#logout.active.focus,
.open > .dropdown-togglespan#login_widget > .button.focus,
.open > .dropdown-toggle#logout.focus {
  color: #333;
  background-color: #d4d4d4;
  border-color: #8c8c8c;
}
span#login_widget > .button:active,
#logout:active,
span#login_widget > .button.active,
#logout.active,
.open > .dropdown-togglespan#login_widget > .button,
.open > .dropdown-toggle#logout {
  background-image: none;
}
span#login_widget > .button.disabled:hover,
#logout.disabled:hover,
span#login_widget > .button[disabled]:hover,
#logout[disabled]:hover,
fieldset[disabled] span#login_widget > .button:hover,
fieldset[disabled] #logout:hover,
span#login_widget > .button.disabled:focus,
#logout.disabled:focus,
span#login_widget > .button[disabled]:focus,
#logout[disabled]:focus,
fieldset[disabled] span#login_widget > .button:focus,
fieldset[disabled] #logout:focus,
span#login_widget > .button.disabled.focus,
#logout.disabled.focus,
span#login_widget > .button[disabled].focus,
#logout[disabled].focus,
fieldset[disabled] span#login_widget > .button.focus,
fieldset[disabled] #logout.focus {
  background-color: #fff;
  border-color: #ccc;
}
span#login_widget > .button .badge,
#logout .badge {
  color: #fff;
  background-color: #333;
}
.nav-header {
  text-transform: none;
}
#header > span {
  margin-top: 10px;
}
.modal_stretch .modal-dialog {
  /* Old browsers */
  display: -webkit-box;
  -webkit-box-orient: vertical;
  -webkit-box-align: stretch;
  display: -moz-box;
  -moz-box-orient: vertical;
  -moz-box-align: stretch;
  display: box;
  box-orient: vertical;
  box-align: stretch;
  /* Modern browsers */
  display: flex;
  flex-direction: column;
  align-items: stretch;
  min-height: 80vh;
}
.modal_stretch .modal-dialog .modal-body {
  max-height: calc(100vh - 200px);
  overflow: auto;
  flex: 1;
}
@media (min-width: 768px) {
  .modal .modal-dialog {
    width: 700px;
  }
}
@media (min-width: 768px) {
  select.form-control {
    margin-left: 12px;
    margin-right: 12px;
  }
}
/*!
*
* IPython auth
*
*/
.center-nav {
  display: inline-block;
  margin-bottom: -4px;
}
/*!
*
* IPython tree view
*
*/
/* We need an invisible input field on top of the sentense*/
/* "Drag file onto the list ..." */
.alternate_upload {
  background-color: none;
  display: inline;
}
.alternate_upload.form {
  padding: 0;
  margin: 0;
}
.alternate_upload input.fileinput {
  text-align: center;
  vertical-align: middle;
  display: inline;
  opacity: 0;
  z-index: 2;
  width: 12ex;
  margin-right: -12ex;
}
.alternate_upload .btn-upload {
  height: 22px;
}
/**
 * Primary styles
 *
 * Author: Jupyter Development Team
 */
ul#tabs {
  margin-bottom: 4px;
}
ul#tabs a {
  padding-top: 6px;
  padding-bottom: 4px;
}
ul.breadcrumb a:focus,
ul.breadcrumb a:hover {
  text-decoration: none;
}
ul.breadcrumb i.icon-home {
  font-size: 16px;
  margin-right: 4px;
}
ul.breadcrumb span {
  color: #5e5e5e;
}
.list_toolbar {
  padding: 4px 0 4px 0;
  vertical-align: middle;
}
.list_toolbar .tree-buttons {
  padding-top: 1px;
}
.dynamic-buttons {
  padding-top: 3px;
  display: inline-block;
}
.list_toolbar [class*="span"] {
  min-height: 24px;
}
.list_header {
  font-weight: bold;
  background-color: #EEE;
}
.list_placeholder {
  font-weight: bold;
  padding-top: 4px;
  padding-bottom: 4px;
  padding-left: 7px;
  padding-right: 7px;
}
.list_container {
  margin-top: 4px;
  margin-bottom: 20px;
  border: 1px solid #ddd;
  border-radius: 2px;
}
.list_container > div {
  border-bottom: 1px solid #ddd;
}
.list_container > div:hover .list-item {
  background-color: red;
}
.list_container > div:last-child {
  border: none;
}
.list_item:hover .list_item {
  background-color: #ddd;
}
.list_item a {
  text-decoration: none;
}
.list_item:hover {
  background-color: #fafafa;
}
.list_header > div,
.list_item > div {
  padding-top: 4px;
  padding-bottom: 4px;
  padding-left: 7px;
  padding-right: 7px;
  line-height: 22px;
}
.list_header > div input,
.list_item > div input {
  margin-right: 7px;
  margin-left: 14px;
  vertical-align: baseline;
  line-height: 22px;
  position: relative;
  top: -1px;
}
.list_header > div .item_link,
.list_item > div .item_link {
  margin-left: -1px;
  vertical-align: baseline;
  line-height: 22px;
}
.new-file input[type=checkbox] {
  visibility: hidden;
}
.item_name {
  line-height: 22px;
  height: 24px;
}
.item_icon {
  font-size: 14px;
  color: #5e5e5e;
  margin-right: 7px;
  margin-left: 7px;
  line-height: 22px;
  vertical-align: baseline;
}
.item_buttons {
  line-height: 1em;
  margin-left: -5px;
}
.item_buttons .btn,
.item_buttons .btn-group,
.item_buttons .input-group {
  float: left;
}
.item_buttons > .btn,
.item_buttons > .btn-group,
.item_buttons > .input-group {
  margin-left: 5px;
}
.item_buttons .btn {
  min-width: 13ex;
}
.item_buttons .running-indicator {
  padding-top: 4px;
  color: #5cb85c;
}
.item_buttons .kernel-name {
  padding-top: 4px;
  color: #5bc0de;
  margin-right: 7px;
  float: left;
}
.toolbar_info {
  height: 24px;
  line-height: 24px;
}
.list_item input:not([type=checkbox]) {
  padding-top: 3px;
  padding-bottom: 3px;
  height: 22px;
  line-height: 14px;
  margin: 0px;
}
.highlight_text {
  color: blue;
}
#project_name {
  display: inline-block;
  padding-left: 7px;
  margin-left: -2px;
}
#project_name > .breadcrumb {
  padding: 0px;
  margin-bottom: 0px;
  background-color: transparent;
  font-weight: bold;
}
#tree-selector {
  padding-right: 0px;
}
#button-select-all {
  min-width: 50px;
}
#select-all {
  margin-left: 7px;
  margin-right: 2px;
}
.menu_icon {
  margin-right: 2px;
}
.tab-content .row {
  margin-left: 0px;
  margin-right: 0px;
}
.folder_icon:before {
  display: inline-block;
  font: normal normal normal 14px/1 FontAwesome;
  font-size: inherit;
  text-rendering: auto;
  -webkit-font-smoothing: antialiased;
  -moz-osx-font-smoothing: grayscale;
  content: "\f114";
}
.folder_icon:before.pull-left {
  margin-right: .3em;
}
.folder_icon:before.pull-right {
  margin-left: .3em;
}
.notebook_icon:before {
  display: inline-block;
  font: normal normal normal 14px/1 FontAwesome;
  font-size: inherit;
  text-rendering: auto;
  -webkit-font-smoothing: antialiased;
  -moz-osx-font-smoothing: grayscale;
  content: "\f02d";
  position: relative;
  top: -1px;
}
.notebook_icon:before.pull-left {
  margin-right: .3em;
}
.notebook_icon:before.pull-right {
  margin-left: .3em;
}
.running_notebook_icon:before {
  display: inline-block;
  font: normal normal normal 14px/1 FontAwesome;
  font-size: inherit;
  text-rendering: auto;
  -webkit-font-smoothing: antialiased;
  -moz-osx-font-smoothing: grayscale;
  content: "\f02d";
  position: relative;
  top: -1px;
  color: #5cb85c;
}
.running_notebook_icon:before.pull-left {
  margin-right: .3em;
}
.running_notebook_icon:before.pull-right {
  margin-left: .3em;
}
.file_icon:before {
  display: inline-block;
  font: normal normal normal 14px/1 FontAwesome;
  font-size: inherit;
  text-rendering: auto;
  -webkit-font-smoothing: antialiased;
  -moz-osx-font-smoothing: grayscale;
  content: "\f016";
  position: relative;
  top: -2px;
}
.file_icon:before.pull-left {
  margin-right: .3em;
}
.file_icon:before.pull-right {
  margin-left: .3em;
}
#notebook_toolbar .pull-right {
  padding-top: 0px;
  margin-right: -1px;
}
ul#new-menu {
  left: auto;
  right: 0;
}
.kernel-menu-icon {
  padding-right: 12px;
  width: 24px;
  content: "\f096";
}
.kernel-menu-icon:before {
  content: "\f096";
}
.kernel-menu-icon-current:before {
  content: "\f00c";
}
#tab_content {
  padding-top: 20px;
}
#running .panel-group .panel {
  margin-top: 3px;
  margin-bottom: 1em;
}
#running .panel-group .panel .panel-heading {
  background-color: #EEE;
  padding-top: 4px;
  padding-bottom: 4px;
  padding-left: 7px;
  padding-right: 7px;
  line-height: 22px;
}
#running .panel-group .panel .panel-heading a:focus,
#running .panel-group .panel .panel-heading a:hover {
  text-decoration: none;
}
#running .panel-group .panel .panel-body {
  padding: 0px;
}
#running .panel-group .panel .panel-body .list_container {
  margin-top: 0px;
  margin-bottom: 0px;
  border: 0px;
  border-radius: 0px;
}
#running .panel-group .panel .panel-body .list_container .list_item {
  border-bottom: 1px solid #ddd;
}
#running .panel-group .panel .panel-body .list_container .list_item:last-child {
  border-bottom: 0px;
}
.delete-button {
  display: none;
}
.duplicate-button {
  display: none;
}
.rename-button {
  display: none;
}
.shutdown-button {
  display: none;
}
.dynamic-instructions {
  display: inline-block;
  padding-top: 4px;
}
/*!
*
* IPython text editor webapp
*
*/
.selected-keymap i.fa {
  padding: 0px 5px;
}
.selected-keymap i.fa:before {
  content: "\f00c";
}
#mode-menu {
  overflow: auto;
  max-height: 20em;
}
.edit_app #header {
  -webkit-box-shadow: 0px 0px 12px 1px rgba(87, 87, 87, 0.2);
  box-shadow: 0px 0px 12px 1px rgba(87, 87, 87, 0.2);
}
.edit_app #menubar .navbar {
  /* Use a negative 1 bottom margin, so the border overlaps the border of the
    header */
  margin-bottom: -1px;
}
.dirty-indicator {
  display: inline-block;
  font: normal normal normal 14px/1 FontAwesome;
  font-size: inherit;
  text-rendering: auto;
  -webkit-font-smoothing: antialiased;
  -moz-osx-font-smoothing: grayscale;
  width: 20px;
}
.dirty-indicator.pull-left {
  margin-right: .3em;
}
.dirty-indicator.pull-right {
  margin-left: .3em;
}
.dirty-indicator-dirty {
  display: inline-block;
  font: normal normal normal 14px/1 FontAwesome;
  font-size: inherit;
  text-rendering: auto;
  -webkit-font-smoothing: antialiased;
  -moz-osx-font-smoothing: grayscale;
  width: 20px;
}
.dirty-indicator-dirty.pull-left {
  margin-right: .3em;
}
.dirty-indicator-dirty.pull-right {
  margin-left: .3em;
}
.dirty-indicator-clean {
  display: inline-block;
  font: normal normal normal 14px/1 FontAwesome;
  font-size: inherit;
  text-rendering: auto;
  -webkit-font-smoothing: antialiased;
  -moz-osx-font-smoothing: grayscale;
  width: 20px;
}
.dirty-indicator-clean.pull-left {
  margin-right: .3em;
}
.dirty-indicator-clean.pull-right {
  margin-left: .3em;
}
.dirty-indicator-clean:before {
  display: inline-block;
  font: normal normal normal 14px/1 FontAwesome;
  font-size: inherit;
  text-rendering: auto;
  -webkit-font-smoothing: antialiased;
  -moz-osx-font-smoothing: grayscale;
  content: "\f00c";
}
.dirty-indicator-clean:before.pull-left {
  margin-right: .3em;
}
.dirty-indicator-clean:before.pull-right {
  margin-left: .3em;
}
#filename {
  font-size: 16pt;
  display: table;
  padding: 0px 5px;
}
#current-mode {
  padding-left: 5px;
  padding-right: 5px;
}
#texteditor-backdrop {
  padding-top: 20px;
  padding-bottom: 20px;
}
@media not print {
  #texteditor-backdrop {
    background-color: #EEE;
  }
}
@media print {
  #texteditor-backdrop #texteditor-container .CodeMirror-gutter,
  #texteditor-backdrop #texteditor-container .CodeMirror-gutters {
    background-color: #fff;
  }
}
@media not print {
  #texteditor-backdrop #texteditor-container .CodeMirror-gutter,
  #texteditor-backdrop #texteditor-container .CodeMirror-gutters {
    background-color: #fff;
  }
}
@media not print {
  #texteditor-backdrop #texteditor-container {
    padding: 0px;
    background-color: #fff;
    -webkit-box-shadow: 0px 0px 12px 1px rgba(87, 87, 87, 0.2);
    box-shadow: 0px 0px 12px 1px rgba(87, 87, 87, 0.2);
  }
}
/*!
*
* IPython notebook
*
*/
/* CSS font colors for translated ANSI colors. */
.ansibold {
  font-weight: bold;
}
/* use dark versions for foreground, to improve visibility */
.ansiblack {
  color: black;
}
.ansired {
  color: darkred;
}
.ansigreen {
  color: darkgreen;
}
.ansiyellow {
  color: #c4a000;
}
.ansiblue {
  color: darkblue;
}
.ansipurple {
  color: darkviolet;
}
.ansicyan {
  color: steelblue;
}
.ansigray {
  color: gray;
}
/* and light for background, for the same reason */
.ansibgblack {
  background-color: black;
}
.ansibgred {
  background-color: red;
}
.ansibggreen {
  background-color: green;
}
.ansibgyellow {
  background-color: yellow;
}
.ansibgblue {
  background-color: blue;
}
.ansibgpurple {
  background-color: magenta;
}
.ansibgcyan {
  background-color: cyan;
}
.ansibggray {
  background-color: gray;
}
div.cell {
  /* Old browsers */
  display: -webkit-box;
  -webkit-box-orient: vertical;
  -webkit-box-align: stretch;
  display: -moz-box;
  -moz-box-orient: vertical;
  -moz-box-align: stretch;
  display: box;
  box-orient: vertical;
  box-align: stretch;
  /* Modern browsers */
  display: flex;
  flex-direction: column;
  align-items: stretch;
  border-radius: 2px;
  box-sizing: border-box;
  -moz-box-sizing: border-box;
  -webkit-box-sizing: border-box;
  border-width: 1px;
  border-style: solid;
  border-color: transparent;
  width: 100%;
  padding: 5px;
  /* This acts as a spacer between cells, that is outside the border */
  margin: 0px;
  outline: none;
  border-left-width: 1px;
  padding-left: 5px;
  background: linear-gradient(to right, transparent -40px, transparent 1px, transparent 1px, transparent 100%);
}
div.cell.jupyter-soft-selected {
  border-left-color: #90CAF9;
  border-left-color: #E3F2FD;
  border-left-width: 1px;
  padding-left: 5px;
  border-right-color: #E3F2FD;
  border-right-width: 1px;
  background: #E3F2FD;
}
@media print {
  div.cell.jupyter-soft-selected {
    border-color: transparent;
  }
}
div.cell.selected {
  border-color: #ababab;
  border-left-width: 0px;
  padding-left: 6px;
  background: linear-gradient(to right, #42A5F5 -40px, #42A5F5 5px, transparent 5px, transparent 100%);
}
@media print {
  div.cell.selected {
    border-color: transparent;
  }
}
div.cell.selected.jupyter-soft-selected {
  border-left-width: 0;
  padding-left: 6px;
  background: linear-gradient(to right, #42A5F5 -40px, #42A5F5 7px, #E3F2FD 7px, #E3F2FD 100%);
}
.edit_mode div.cell.selected {
  border-color: #66BB6A;
  border-left-width: 0px;
  padding-left: 6px;
  background: linear-gradient(to right, #66BB6A -40px, #66BB6A 5px, transparent 5px, transparent 100%);
}
@media print {
  .edit_mode div.cell.selected {
    border-color: transparent;
  }
}
.prompt {
  /* This needs to be wide enough for 3 digit prompt numbers: In[100]: */
  min-width: 14ex;
  /* This padding is tuned to match the padding on the CodeMirror editor. */
  padding: 0.4em;
  margin: 0px;
  font-family: monospace;
  text-align: right;
  /* This has to match that of the the CodeMirror class line-height below */
  line-height: 1.21429em;
  /* Don't highlight prompt number selection */
  -webkit-touch-callout: none;
  -webkit-user-select: none;
  -khtml-user-select: none;
  -moz-user-select: none;
  -ms-user-select: none;
  user-select: none;
  /* Use default cursor */
  cursor: default;
}
@media (max-width: 540px) {
  .prompt {
    text-align: left;
  }
}
div.inner_cell {
  /* Old browsers */
  display: -webkit-box;
  -webkit-box-orient: vertical;
  -webkit-box-align: stretch;
  display: -moz-box;
  -moz-box-orient: vertical;
  -moz-box-align: stretch;
  display: box;
  box-orient: vertical;
  box-align: stretch;
  /* Modern browsers */
  display: flex;
  flex-direction: column;
  align-items: stretch;
  /* Old browsers */
  -webkit-box-flex: 1;
  -moz-box-flex: 1;
  box-flex: 1;
  /* Modern browsers */
  flex: 1;
}
@-moz-document url-prefix() {
  div.inner_cell {
    overflow-x: hidden;
  }
}
/* input_area and input_prompt must match in top border and margin for alignment */
div.input_area {
  border: 1px solid #cfcfcf;
  border-radius: 2px;
  background: #f7f7f7;
  line-height: 1.21429em;
}
/* This is needed so that empty prompt areas can collapse to zero height when there
   is no content in the output_subarea and the prompt. The main purpose of this is
   to make sure that empty JavaScript output_subareas have no height. */
div.prompt:empty {
  padding-top: 0;
  padding-bottom: 0;
}
div.unrecognized_cell {
  padding: 5px 5px 5px 0px;
  /* Old browsers */
  display: -webkit-box;
  -webkit-box-orient: horizontal;
  -webkit-box-align: stretch;
  display: -moz-box;
  -moz-box-orient: horizontal;
  -moz-box-align: stretch;
  display: box;
  box-orient: horizontal;
  box-align: stretch;
  /* Modern browsers */
  display: flex;
  flex-direction: row;
  align-items: stretch;
}
div.unrecognized_cell .inner_cell {
  border-radius: 2px;
  padding: 5px;
  font-weight: bold;
  color: red;
  border: 1px solid #cfcfcf;
  background: #eaeaea;
}
div.unrecognized_cell .inner_cell a {
  color: inherit;
  text-decoration: none;
}
div.unrecognized_cell .inner_cell a:hover {
  color: inherit;
  text-decoration: none;
}
@media (max-width: 540px) {
  div.unrecognized_cell > div.prompt {
    display: none;
  }
}
div.code_cell {
  /* avoid page breaking on code cells when printing */
}
@media print {
  div.code_cell {
    page-break-inside: avoid;
  }
}
/* any special styling for code cells that are currently running goes here */
div.input {
  page-break-inside: avoid;
  /* Old browsers */
  display: -webkit-box;
  -webkit-box-orient: horizontal;
  -webkit-box-align: stretch;
  display: -moz-box;
  -moz-box-orient: horizontal;
  -moz-box-align: stretch;
  display: box;
  box-orient: horizontal;
  box-align: stretch;
  /* Modern browsers */
  display: flex;
  flex-direction: row;
  align-items: stretch;
}
@media (max-width: 540px) {
  div.input {
    /* Old browsers */
    display: -webkit-box;
    -webkit-box-orient: vertical;
    -webkit-box-align: stretch;
    display: -moz-box;
    -moz-box-orient: vertical;
    -moz-box-align: stretch;
    display: box;
    box-orient: vertical;
    box-align: stretch;
    /* Modern browsers */
    display: flex;
    flex-direction: column;
    align-items: stretch;
  }
}
/* input_area and input_prompt must match in top border and margin for alignment */
div.input_prompt {
  color: #303F9F;
  border-top: 1px solid transparent;
}
div.input_area > div.highlight {
  margin: 0.4em;
  border: none;
  padding: 0px;
  background-color: transparent;
}
div.input_area > div.highlight > pre {
  margin: 0px;
  border: none;
  padding: 0px;
  background-color: transparent;
}
/* The following gets added to the <head> if it is detected that the user has a
 * monospace font with inconsistent normal/bold/italic height.  See
 * notebookmain.js.  Such fonts will have keywords vertically offset with
 * respect to the rest of the text.  The user should select a better font.
 * See: https://github.com/ipython/ipython/issues/1503
 *
 * .CodeMirror span {
 *      vertical-align: bottom;
 * }
 */
.CodeMirror {
  line-height: 1.21429em;
  /* Changed from 1em to our global default */
  font-size: 14px;
  height: auto;
  /* Changed to auto to autogrow */
  background: none;
  /* Changed from white to allow our bg to show through */
}
.CodeMirror-scroll {
  /*  The CodeMirror docs are a bit fuzzy on if overflow-y should be hidden or visible.*/
  /*  We have found that if it is visible, vertical scrollbars appear with font size changes.*/
  overflow-y: hidden;
  overflow-x: auto;
}
.CodeMirror-lines {
  /* In CM2, this used to be 0.4em, but in CM3 it went to 4px. We need the em value because */
  /* we have set a different line-height and want this to scale with that. */
  padding: 0.4em;
}
.CodeMirror-linenumber {
  padding: 0 8px 0 4px;
}
.CodeMirror-gutters {
  border-bottom-left-radius: 2px;
  border-top-left-radius: 2px;
}
.CodeMirror pre {
  /* In CM3 this went to 4px from 0 in CM2. We need the 0 value because of how we size */
  /* .CodeMirror-lines */
  padding: 0;
  border: 0;
  border-radius: 0;
}
/*

Original style from softwaremaniacs.org (c) Ivan Sagalaev <Maniac@SoftwareManiacs.Org>
Adapted from GitHub theme

*/
.highlight-base {
  color: #000;
}
.highlight-variable {
  color: #000;
}
.highlight-variable-2 {
  color: #1a1a1a;
}
.highlight-variable-3 {
  color: #333333;
}
.highlight-string {
  color: #BA2121;
}
.highlight-comment {
  color: #408080;
  font-style: italic;
}
.highlight-number {
  color: #080;
}
.highlight-atom {
  color: #88F;
}
.highlight-keyword {
  color: #008000;
  font-weight: bold;
}
.highlight-builtin {
  color: #008000;
}
.highlight-error {
  color: #f00;
}
.highlight-operator {
  color: #AA22FF;
  font-weight: bold;
}
.highlight-meta {
  color: #AA22FF;
}
/* previously not defined, copying from default codemirror */
.highlight-def {
  color: #00f;
}
.highlight-string-2 {
  color: #f50;
}
.highlight-qualifier {
  color: #555;
}
.highlight-bracket {
  color: #997;
}
.highlight-tag {
  color: #170;
}
.highlight-attribute {
  color: #00c;
}
.highlight-header {
  color: blue;
}
.highlight-quote {
  color: #090;
}
.highlight-link {
  color: #00c;
}
/* apply the same style to codemirror */
.cm-s-ipython span.cm-keyword {
  color: #008000;
  font-weight: bold;
}
.cm-s-ipython span.cm-atom {
  color: #88F;
}
.cm-s-ipython span.cm-number {
  color: #080;
}
.cm-s-ipython span.cm-def {
  color: #00f;
}
.cm-s-ipython span.cm-variable {
  color: #000;
}
.cm-s-ipython span.cm-operator {
  color: #AA22FF;
  font-weight: bold;
}
.cm-s-ipython span.cm-variable-2 {
  color: #1a1a1a;
}
.cm-s-ipython span.cm-variable-3 {
  color: #333333;
}
.cm-s-ipython span.cm-comment {
  color: #408080;
  font-style: italic;
}
.cm-s-ipython span.cm-string {
  color: #BA2121;
}
.cm-s-ipython span.cm-string-2 {
  color: #f50;
}
.cm-s-ipython span.cm-meta {
  color: #AA22FF;
}
.cm-s-ipython span.cm-qualifier {
  color: #555;
}
.cm-s-ipython span.cm-builtin {
  color: #008000;
}
.cm-s-ipython span.cm-bracket {
  color: #997;
}
.cm-s-ipython span.cm-tag {
  color: #170;
}
.cm-s-ipython span.cm-attribute {
  color: #00c;
}
.cm-s-ipython span.cm-header {
  color: blue;
}
.cm-s-ipython span.cm-quote {
  color: #090;
}
.cm-s-ipython span.cm-link {
  color: #00c;
}
.cm-s-ipython span.cm-error {
  color: #f00;
}
.cm-s-ipython span.cm-tab {
  background: url(data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAADAAAAAMCAYAAAAkuj5RAAAAAXNSR0IArs4c6QAAAGFJREFUSMft1LsRQFAQheHPowAKoACx3IgEKtaEHujDjORSgWTH/ZOdnZOcM/sgk/kFFWY0qV8foQwS4MKBCS3qR6ixBJvElOobYAtivseIE120FaowJPN75GMu8j/LfMwNjh4HUpwg4LUAAAAASUVORK5CYII=);
  background-position: right;
  background-repeat: no-repeat;
}
div.output_wrapper {
  /* this position must be relative to enable descendents to be absolute within it */
  position: relative;
  /* Old browsers */
  display: -webkit-box;
  -webkit-box-orient: vertical;
  -webkit-box-align: stretch;
  display: -moz-box;
  -moz-box-orient: vertical;
  -moz-box-align: stretch;
  display: box;
  box-orient: vertical;
  box-align: stretch;
  /* Modern browsers */
  display: flex;
  flex-direction: column;
  align-items: stretch;
  z-index: 1;
}
/* class for the output area when it should be height-limited */
div.output_scroll {
  /* ideally, this would be max-height, but FF barfs all over that */
  height: 24em;
  /* FF needs this *and the wrapper* to specify full width, or it will shrinkwrap */
  width: 100%;
  overflow: auto;
  border-radius: 2px;
  -webkit-box-shadow: inset 0 2px 8px rgba(0, 0, 0, 0.8);
  box-shadow: inset 0 2px 8px rgba(0, 0, 0, 0.8);
  display: block;
}
/* output div while it is collapsed */
div.output_collapsed {
  margin: 0px;
  padding: 0px;
  /* Old browsers */
  display: -webkit-box;
  -webkit-box-orient: vertical;
  -webkit-box-align: stretch;
  display: -moz-box;
  -moz-box-orient: vertical;
  -moz-box-align: stretch;
  display: box;
  box-orient: vertical;
  box-align: stretch;
  /* Modern browsers */
  display: flex;
  flex-direction: column;
  align-items: stretch;
}
div.out_prompt_overlay {
  height: 100%;
  padding: 0px 0.4em;
  position: absolute;
  border-radius: 2px;
}
div.out_prompt_overlay:hover {
  /* use inner shadow to get border that is computed the same on WebKit/FF */
  -webkit-box-shadow: inset 0 0 1px #000;
  box-shadow: inset 0 0 1px #000;
  background: rgba(240, 240, 240, 0.5);
}
div.output_prompt {
  color: #D84315;
}
/* This class is the outer container of all output sections. */
div.output_area {
  padding: 0px;
  page-break-inside: avoid;
  /* Old browsers */
  display: -webkit-box;
  -webkit-box-orient: horizontal;
  -webkit-box-align: stretch;
  display: -moz-box;
  -moz-box-orient: horizontal;
  -moz-box-align: stretch;
  display: box;
  box-orient: horizontal;
  box-align: stretch;
  /* Modern browsers */
  display: flex;
  flex-direction: row;
  align-items: stretch;
}
div.output_area .MathJax_Display {
  text-align: left !important;
}
div.output_area .rendered_html table {
  margin-left: 0;
  margin-right: 0;
}
div.output_area .rendered_html img {
  margin-left: 0;
  margin-right: 0;
}
div.output_area img,
div.output_area svg {
  max-width: 100%;
  height: auto;
}
div.output_area img.unconfined,
div.output_area svg.unconfined {
  max-width: none;
}
/* This is needed to protect the pre formating from global settings such
   as that of bootstrap */
.output {
  /* Old browsers */
  display: -webkit-box;
  -webkit-box-orient: vertical;
  -webkit-box-align: stretch;
  display: -moz-box;
  -moz-box-orient: vertical;
  -moz-box-align: stretch;
  display: box;
  box-orient: vertical;
  box-align: stretch;
  /* Modern browsers */
  display: flex;
  flex-direction: column;
  align-items: stretch;
}
@media (max-width: 540px) {
  div.output_area {
    /* Old browsers */
    display: -webkit-box;
    -webkit-box-orient: vertical;
    -webkit-box-align: stretch;
    display: -moz-box;
    -moz-box-orient: vertical;
    -moz-box-align: stretch;
    display: box;
    box-orient: vertical;
    box-align: stretch;
    /* Modern browsers */
    display: flex;
    flex-direction: column;
    align-items: stretch;
  }
}
div.output_area pre {
  margin: 0;
  padding: 0;
  border: 0;
  vertical-align: baseline;
  color: black;
  background-color: transparent;
  border-radius: 0;
}
/* This class is for the output subarea inside the output_area and after
   the prompt div. */
div.output_subarea {
  overflow-x: auto;
  padding: 0.4em;
  /* Old browsers */
  -webkit-box-flex: 1;
  -moz-box-flex: 1;
  box-flex: 1;
  /* Modern browsers */
  flex: 1;
  max-width: calc(100% - 14ex);
}
div.output_scroll div.output_subarea {
  overflow-x: visible;
}
/* The rest of the output_* classes are for special styling of the different
   output types */
/* all text output has this class: */
div.output_text {
  text-align: left;
  color: #000;
  /* This has to match that of the the CodeMirror class line-height below */
  line-height: 1.21429em;
}
/* stdout/stderr are 'text' as well as 'stream', but execute_result/error are *not* streams */
div.output_stderr {
  background: #fdd;
  /* very light red background for stderr */
}
div.output_latex {
  text-align: left;
}
/* Empty output_javascript divs should have no height */
div.output_javascript:empty {
  padding: 0;
}
.js-error {
  color: darkred;
}
/* raw_input styles */
div.raw_input_container {
  line-height: 1.21429em;
  padding-top: 5px;
}
pre.raw_input_prompt {
  /* nothing needed here. */
}
input.raw_input {
  font-family: monospace;
  font-size: inherit;
  color: inherit;
  width: auto;
  /* make sure input baseline aligns with prompt */
  vertical-align: baseline;
  /* padding + margin = 0.5em between prompt and cursor */
  padding: 0em 0.25em;
  margin: 0em 0.25em;
}
input.raw_input:focus {
  box-shadow: none;
}
p.p-space {
  margin-bottom: 10px;
}
div.output_unrecognized {
  padding: 5px;
  font-weight: bold;
  color: red;
}
div.output_unrecognized a {
  color: inherit;
  text-decoration: none;
}
div.output_unrecognized a:hover {
  color: inherit;
  text-decoration: none;
}
.rendered_html {
  color: #000;
  /* any extras will just be numbers: */
}
.rendered_html em {
  font-style: italic;
}
.rendered_html strong {
  font-weight: bold;
}
.rendered_html u {
  text-decoration: underline;
}
.rendered_html :link {
  text-decoration: underline;
}
.rendered_html :visited {
  text-decoration: underline;
}
.rendered_html h1 {
  font-size: 185.7%;
  margin: 1.08em 0 0 0;
  font-weight: bold;
  line-height: 1.0;
}
.rendered_html h2 {
  font-size: 157.1%;
  margin: 1.27em 0 0 0;
  font-weight: bold;
  line-height: 1.0;
}
.rendered_html h3 {
  font-size: 128.6%;
  margin: 1.55em 0 0 0;
  font-weight: bold;
  line-height: 1.0;
}
.rendered_html h4 {
  font-size: 100%;
  margin: 2em 0 0 0;
  font-weight: bold;
  line-height: 1.0;
}
.rendered_html h5 {
  font-size: 100%;
  margin: 2em 0 0 0;
  font-weight: bold;
  line-height: 1.0;
  font-style: italic;
}
.rendered_html h6 {
  font-size: 100%;
  margin: 2em 0 0 0;
  font-weight: bold;
  line-height: 1.0;
  font-style: italic;
}
.rendered_html h1:first-child {
  margin-top: 0.538em;
}
.rendered_html h2:first-child {
  margin-top: 0.636em;
}
.rendered_html h3:first-child {
  margin-top: 0.777em;
}
.rendered_html h4:first-child {
  margin-top: 1em;
}
.rendered_html h5:first-child {
  margin-top: 1em;
}
.rendered_html h6:first-child {
  margin-top: 1em;
}
.rendered_html ul {
  list-style: disc;
  margin: 0em 2em;
  padding-left: 0px;
}
.rendered_html ul ul {
  list-style: square;
  margin: 0em 2em;
}
.rendered_html ul ul ul {
  list-style: circle;
  margin: 0em 2em;
}
.rendered_html ol {
  list-style: decimal;
  margin: 0em 2em;
  padding-left: 0px;
}
.rendered_html ol ol {
  list-style: upper-alpha;
  margin: 0em 2em;
}
.rendered_html ol ol ol {
  list-style: lower-alpha;
  margin: 0em 2em;
}
.rendered_html ol ol ol ol {
  list-style: lower-roman;
  margin: 0em 2em;
}
.rendered_html ol ol ol ol ol {
  list-style: decimal;
  margin: 0em 2em;
}
.rendered_html * + ul {
  margin-top: 1em;
}
.rendered_html * + ol {
  margin-top: 1em;
}
.rendered_html hr {
  color: black;
  background-color: black;
}
.rendered_html pre {
  margin: 1em 2em;
}
.rendered_html pre,
.rendered_html code {
  border: 0;
  background-color: #fff;
  color: #000;
  font-size: 100%;
  padding: 0px;
}
.rendered_html blockquote {
  margin: 1em 2em;
}
.rendered_html table {
  margin-left: auto;
  margin-right: auto;
  border: 1px solid black;
  border-collapse: collapse;
}
.rendered_html tr,
.rendered_html th,
.rendered_html td {
  border: 1px solid black;
  border-collapse: collapse;
  margin: 1em 2em;
}
.rendered_html td,
.rendered_html th {
  text-align: left;
  vertical-align: middle;
  padding: 4px;
}
.rendered_html th {
  font-weight: bold;
}
.rendered_html * + table {
  margin-top: 1em;
}
.rendered_html p {
  text-align: left;
}
.rendered_html * + p {
  margin-top: 1em;
}
.rendered_html img {
  display: block;
  margin-left: auto;
  margin-right: auto;
}
.rendered_html * + img {
  margin-top: 1em;
}
.rendered_html img,
.rendered_html svg {
  max-width: 100%;
  height: auto;
}
.rendered_html img.unconfined,
.rendered_html svg.unconfined {
  max-width: none;
}
div.text_cell {
  /* Old browsers */
  display: -webkit-box;
  -webkit-box-orient: horizontal;
  -webkit-box-align: stretch;
  display: -moz-box;
  -moz-box-orient: horizontal;
  -moz-box-align: stretch;
  display: box;
  box-orient: horizontal;
  box-align: stretch;
  /* Modern browsers */
  display: flex;
  flex-direction: row;
  align-items: stretch;
}
@media (max-width: 540px) {
  div.text_cell > div.prompt {
    display: none;
  }
}
div.text_cell_render {
  /*font-family: "Helvetica Neue", Arial, Helvetica, Geneva, sans-serif;*/
  outline: none;
  resize: none;
  width: inherit;
  border-style: none;
  padding: 0.5em 0.5em 0.5em 0.4em;
  color: #000;
  box-sizing: border-box;
  -moz-box-sizing: border-box;
  -webkit-box-sizing: border-box;
}
a.anchor-link:link {
  text-decoration: none;
  padding: 0px 20px;
  visibility: hidden;
}
h1:hover .anchor-link,
h2:hover .anchor-link,
h3:hover .anchor-link,
h4:hover .anchor-link,
h5:hover .anchor-link,
h6:hover .anchor-link {
  visibility: visible;
}
.text_cell.rendered .input_area {
  display: none;
}
.text_cell.rendered .rendered_html {
  overflow-x: auto;
  overflow-y: hidden;
}
.text_cell.unrendered .text_cell_render {
  display: none;
}
.cm-header-1,
.cm-header-2,
.cm-header-3,
.cm-header-4,
.cm-header-5,
.cm-header-6 {
  font-weight: bold;
  font-family: "Helvetica Neue", Helvetica, Arial, sans-serif;
}
.cm-header-1 {
  font-size: 185.7%;
}
.cm-header-2 {
  font-size: 157.1%;
}
.cm-header-3 {
  font-size: 128.6%;
}
.cm-header-4 {
  font-size: 110%;
}
.cm-header-5 {
  font-size: 100%;
  font-style: italic;
}
.cm-header-6 {
  font-size: 100%;
  font-style: italic;
}
/*!
*
* IPython notebook webapp
*
*/
@media (max-width: 767px) {
  .notebook_app {
    padding-left: 0px;
    padding-right: 0px;
  }
}
#ipython-main-app {
  box-sizing: border-box;
  -moz-box-sizing: border-box;
  -webkit-box-sizing: border-box;
  height: 100%;
}
div#notebook_panel {
  margin: 0px;
  padding: 0px;
  box-sizing: border-box;
  -moz-box-sizing: border-box;
  -webkit-box-sizing: border-box;
  height: 100%;
}
div#notebook {
  font-size: 14px;
  line-height: 20px;
  overflow-y: hidden;
  overflow-x: auto;
  width: 100%;
  /* This spaces the page away from the edge of the notebook area */
  padding-top: 20px;
  margin: 0px;
  outline: none;
  box-sizing: border-box;
  -moz-box-sizing: border-box;
  -webkit-box-sizing: border-box;
  min-height: 100%;
}
@media not print {
  #notebook-container {
    padding: 15px;
    background-color: #fff;
    min-height: 0;
    -webkit-box-shadow: 0px 0px 12px 1px rgba(87, 87, 87, 0.2);
    box-shadow: 0px 0px 12px 1px rgba(87, 87, 87, 0.2);
  }
}
@media print {
  #notebook-container {
    width: 100%;
  }
}
div.ui-widget-content {
  border: 1px solid #ababab;
  outline: none;
}
pre.dialog {
  background-color: #f7f7f7;
  border: 1px solid #ddd;
  border-radius: 2px;
  padding: 0.4em;
  padding-left: 2em;
}
p.dialog {
  padding: 0.2em;
}
/* Word-wrap output correctly.  This is the CSS3 spelling, though Firefox seems
   to not honor it correctly.  Webkit browsers (Chrome, rekonq, Safari) do.
 */
pre,
code,
kbd,
samp {
  white-space: pre-wrap;
}
#fonttest {
  font-family: monospace;
}
p {
  margin-bottom: 0;
}
.end_space {
  min-height: 100px;
  transition: height .2s ease;
}
.notebook_app > #header {
  -webkit-box-shadow: 0px 0px 12px 1px rgba(87, 87, 87, 0.2);
  box-shadow: 0px 0px 12px 1px rgba(87, 87, 87, 0.2);
}
@media not print {
  .notebook_app {
    background-color: #EEE;
  }
}
kbd {
  border-style: solid;
  border-width: 1px;
  box-shadow: none;
  margin: 2px;
  padding-left: 2px;
  padding-right: 2px;
  padding-top: 1px;
  padding-bottom: 1px;
}
/* CSS for the cell toolbar */
.celltoolbar {
  border: thin solid #CFCFCF;
  border-bottom: none;
  background: #EEE;
  border-radius: 2px 2px 0px 0px;
  width: 100%;
  height: 29px;
  padding-right: 4px;
  /* Old browsers */
  display: -webkit-box;
  -webkit-box-orient: horizontal;
  -webkit-box-align: stretch;
  display: -moz-box;
  -moz-box-orient: horizontal;
  -moz-box-align: stretch;
  display: box;
  box-orient: horizontal;
  box-align: stretch;
  /* Modern browsers */
  display: flex;
  flex-direction: row;
  align-items: stretch;
  /* Old browsers */
  -webkit-box-pack: end;
  -moz-box-pack: end;
  box-pack: end;
  /* Modern browsers */
  justify-content: flex-end;
  display: -webkit-flex;
}
@media print {
  .celltoolbar {
    display: none;
  }
}
.ctb_hideshow {
  display: none;
  vertical-align: bottom;
}
/* ctb_show is added to the ctb_hideshow div to show the cell toolbar.
   Cell toolbars are only shown when the ctb_global_show class is also set.
*/
.ctb_global_show .ctb_show.ctb_hideshow {
  display: block;
}
.ctb_global_show .ctb_show + .input_area,
.ctb_global_show .ctb_show + div.text_cell_input,
.ctb_global_show .ctb_show ~ div.text_cell_render {
  border-top-right-radius: 0px;
  border-top-left-radius: 0px;
}
.ctb_global_show .ctb_show ~ div.text_cell_render {
  border: 1px solid #cfcfcf;
}
.celltoolbar {
  font-size: 87%;
  padding-top: 3px;
}
.celltoolbar select {
  display: block;
  width: 100%;
  height: 32px;
  padding: 6px 12px;
  font-size: 13px;
  line-height: 1.42857143;
  color: #555555;
  background-color: #fff;
  background-image: none;
  border: 1px solid #ccc;
  border-radius: 2px;
  -webkit-box-shadow: inset 0 1px 1px rgba(0, 0, 0, 0.075);
  box-shadow: inset 0 1px 1px rgba(0, 0, 0, 0.075);
  -webkit-transition: border-color ease-in-out .15s, box-shadow ease-in-out .15s;
  -o-transition: border-color ease-in-out .15s, box-shadow ease-in-out .15s;
  transition: border-color ease-in-out .15s, box-shadow ease-in-out .15s;
  height: 30px;
  padding: 5px 10px;
  font-size: 12px;
  line-height: 1.5;
  border-radius: 1px;
  width: inherit;
  font-size: inherit;
  height: 22px;
  padding: 0px;
  display: inline-block;
}
.celltoolbar select:focus {
  border-color: #66afe9;
  outline: 0;
  -webkit-box-shadow: inset 0 1px 1px rgba(0,0,0,.075), 0 0 8px rgba(102, 175, 233, 0.6);
  box-shadow: inset 0 1px 1px rgba(0,0,0,.075), 0 0 8px rgba(102, 175, 233, 0.6);
}
.celltoolbar select::-moz-placeholder {
  color: #999;
  opacity: 1;
}
.celltoolbar select:-ms-input-placeholder {
  color: #999;
}
.celltoolbar select::-webkit-input-placeholder {
  color: #999;
}
.celltoolbar select::-ms-expand {
  border: 0;
  background-color: transparent;
}
.celltoolbar select[disabled],
.celltoolbar select[readonly],
fieldset[disabled] .celltoolbar select {
  background-color: #eeeeee;
  opacity: 1;
}
.celltoolbar select[disabled],
fieldset[disabled] .celltoolbar select {
  cursor: not-allowed;
}
textarea.celltoolbar select {
  height: auto;
}
select.celltoolbar select {
  height: 30px;
  line-height: 30px;
}
textarea.celltoolbar select,
select[multiple].celltoolbar select {
  height: auto;
}
.celltoolbar label {
  margin-left: 5px;
  margin-right: 5px;
}
.completions {
  position: absolute;
  z-index: 110;
  overflow: hidden;
  border: 1px solid #ababab;
  border-radius: 2px;
  -webkit-box-shadow: 0px 6px 10px -1px #adadad;
  box-shadow: 0px 6px 10px -1px #adadad;
  line-height: 1;
}
.completions select {
  background: white;
  outline: none;
  border: none;
  padding: 0px;
  margin: 0px;
  overflow: auto;
  font-family: monospace;
  font-size: 110%;
  color: #000;
  width: auto;
}
.completions select option.context {
  color: #286090;
}
#kernel_logo_widget {
  float: right !important;
  float: right;
}
#kernel_logo_widget .current_kernel_logo {
  display: none;
  margin-top: -1px;
  margin-bottom: -1px;
  width: 32px;
  height: 32px;
}
#menubar {
  box-sizing: border-box;
  -moz-box-sizing: border-box;
  -webkit-box-sizing: border-box;
  margin-top: 1px;
}
#menubar .navbar {
  border-top: 1px;
  border-radius: 0px 0px 2px 2px;
  margin-bottom: 0px;
}
#menubar .navbar-toggle {
  float: left;
  padding-top: 7px;
  padding-bottom: 7px;
  border: none;
}
#menubar .navbar-collapse {
  clear: left;
}
.nav-wrapper {
  border-bottom: 1px solid #e7e7e7;
}
i.menu-icon {
  padding-top: 4px;
}
ul#help_menu li a {
  overflow: hidden;
  padding-right: 2.2em;
}
ul#help_menu li a i {
  margin-right: -1.2em;
}
.dropdown-submenu {
  position: relative;
}
.dropdown-submenu > .dropdown-menu {
  top: 0;
  left: 100%;
  margin-top: -6px;
  margin-left: -1px;
}
.dropdown-submenu:hover > .dropdown-menu {
  display: block;
}
.dropdown-submenu > a:after {
  display: inline-block;
  font: normal normal normal 14px/1 FontAwesome;
  font-size: inherit;
  text-rendering: auto;
  -webkit-font-smoothing: antialiased;
  -moz-osx-font-smoothing: grayscale;
  display: block;
  content: "\f0da";
  float: right;
  color: #333333;
  margin-top: 2px;
  margin-right: -10px;
}
.dropdown-submenu > a:after.pull-left {
  margin-right: .3em;
}
.dropdown-submenu > a:after.pull-right {
  margin-left: .3em;
}
.dropdown-submenu:hover > a:after {
  color: #262626;
}
.dropdown-submenu.pull-left {
  float: none;
}
.dropdown-submenu.pull-left > .dropdown-menu {
  left: -100%;
  margin-left: 10px;
}
#notification_area {
  float: right !important;
  float: right;
  z-index: 10;
}
.indicator_area {
  float: right !important;
  float: right;
  color: #777;
  margin-left: 5px;
  margin-right: 5px;
  width: 11px;
  z-index: 10;
  text-align: center;
  width: auto;
}
#kernel_indicator {
  float: right !important;
  float: right;
  color: #777;
  margin-left: 5px;
  margin-right: 5px;
  width: 11px;
  z-index: 10;
  text-align: center;
  width: auto;
  border-left: 1px solid;
}
#kernel_indicator .kernel_indicator_name {
  padding-left: 5px;
  padding-right: 5px;
}
#modal_indicator {
  float: right !important;
  float: right;
  color: #777;
  margin-left: 5px;
  margin-right: 5px;
  width: 11px;
  z-index: 10;
  text-align: center;
  width: auto;
}
#readonly-indicator {
  float: right !important;
  float: right;
  color: #777;
  margin-left: 5px;
  margin-right: 5px;
  width: 11px;
  z-index: 10;
  text-align: center;
  width: auto;
  margin-top: 2px;
  margin-bottom: 0px;
  margin-left: 0px;
  margin-right: 0px;
  display: none;
}
.modal_indicator:before {
  width: 1.28571429em;
  text-align: center;
}
.edit_mode .modal_indicator:before {
  display: inline-block;
  font: normal normal normal 14px/1 FontAwesome;
  font-size: inherit;
  text-rendering: auto;
  -webkit-font-smoothing: antialiased;
  -moz-osx-font-smoothing: grayscale;
  content: "\f040";
}
.edit_mode .modal_indicator:before.pull-left {
  margin-right: .3em;
}
.edit_mode .modal_indicator:before.pull-right {
  margin-left: .3em;
}
.command_mode .modal_indicator:before {
  display: inline-block;
  font: normal normal normal 14px/1 FontAwesome;
  font-size: inherit;
  text-rendering: auto;
  -webkit-font-smoothing: antialiased;
  -moz-osx-font-smoothing: grayscale;
  content: ' ';
}
.command_mode .modal_indicator:before.pull-left {
  margin-right: .3em;
}
.command_mode .modal_indicator:before.pull-right {
  margin-left: .3em;
}
.kernel_idle_icon:before {
  display: inline-block;
  font: normal normal normal 14px/1 FontAwesome;
  font-size: inherit;
  text-rendering: auto;
  -webkit-font-smoothing: antialiased;
  -moz-osx-font-smoothing: grayscale;
  content: "\f10c";
}
.kernel_idle_icon:before.pull-left {
  margin-right: .3em;
}
.kernel_idle_icon:before.pull-right {
  margin-left: .3em;
}
.kernel_busy_icon:before {
  display: inline-block;
  font: normal normal normal 14px/1 FontAwesome;
  font-size: inherit;
  text-rendering: auto;
  -webkit-font-smoothing: antialiased;
  -moz-osx-font-smoothing: grayscale;
  content: "\f111";
}
.kernel_busy_icon:before.pull-left {
  margin-right: .3em;
}
.kernel_busy_icon:before.pull-right {
  margin-left: .3em;
}
.kernel_dead_icon:before {
  display: inline-block;
  font: normal normal normal 14px/1 FontAwesome;
  font-size: inherit;
  text-rendering: auto;
  -webkit-font-smoothing: antialiased;
  -moz-osx-font-smoothing: grayscale;
  content: "\f1e2";
}
.kernel_dead_icon:before.pull-left {
  margin-right: .3em;
}
.kernel_dead_icon:before.pull-right {
  margin-left: .3em;
}
.kernel_disconnected_icon:before {
  display: inline-block;
  font: normal normal normal 14px/1 FontAwesome;
  font-size: inherit;
  text-rendering: auto;
  -webkit-font-smoothing: antialiased;
  -moz-osx-font-smoothing: grayscale;
  content: "\f127";
}
.kernel_disconnected_icon:before.pull-left {
  margin-right: .3em;
}
.kernel_disconnected_icon:before.pull-right {
  margin-left: .3em;
}
.notification_widget {
  color: #777;
  z-index: 10;
  background: rgba(240, 240, 240, 0.5);
  margin-right: 4px;
  color: #333;
  background-color: #fff;
  border-color: #ccc;
}
.notification_widget:focus,
.notification_widget.focus {
  color: #333;
  background-color: #e6e6e6;
  border-color: #8c8c8c;
}
.notification_widget:hover {
  color: #333;
  background-color: #e6e6e6;
  border-color: #adadad;
}
.notification_widget:active,
.notification_widget.active,
.open > .dropdown-toggle.notification_widget {
  color: #333;
  background-color: #e6e6e6;
  border-color: #adadad;
}
.notification_widget:active:hover,
.notification_widget.active:hover,
.open > .dropdown-toggle.notification_widget:hover,
.notification_widget:active:focus,
.notification_widget.active:focus,
.open > .dropdown-toggle.notification_widget:focus,
.notification_widget:active.focus,
.notification_widget.active.focus,
.open > .dropdown-toggle.notification_widget.focus {
  color: #333;
  background-color: #d4d4d4;
  border-color: #8c8c8c;
}
.notification_widget:active,
.notification_widget.active,
.open > .dropdown-toggle.notification_widget {
  background-image: none;
}
.notification_widget.disabled:hover,
.notification_widget[disabled]:hover,
fieldset[disabled] .notification_widget:hover,
.notification_widget.disabled:focus,
.notification_widget[disabled]:focus,
fieldset[disabled] .notification_widget:focus,
.notification_widget.disabled.focus,
.notification_widget[disabled].focus,
fieldset[disabled] .notification_widget.focus {
  background-color: #fff;
  border-color: #ccc;
}
.notification_widget .badge {
  color: #fff;
  background-color: #333;
}
.notification_widget.warning {
  color: #fff;
  background-color: #f0ad4e;
  border-color: #eea236;
}
.notification_widget.warning:focus,
.notification_widget.warning.focus {
  color: #fff;
  background-color: #ec971f;
  border-color: #985f0d;
}
.notification_widget.warning:hover {
  color: #fff;
  background-color: #ec971f;
  border-color: #d58512;
}
.notification_widget.warning:active,
.notification_widget.warning.active,
.open > .dropdown-toggle.notification_widget.warning {
  color: #fff;
  background-color: #ec971f;
  border-color: #d58512;
}
.notification_widget.warning:active:hover,
.notification_widget.warning.active:hover,
.open > .dropdown-toggle.notification_widget.warning:hover,
.notification_widget.warning:active:focus,
.notification_widget.warning.active:focus,
.open > .dropdown-toggle.notification_widget.warning:focus,
.notification_widget.warning:active.focus,
.notification_widget.warning.active.focus,
.open > .dropdown-toggle.notification_widget.warning.focus {
  color: #fff;
  background-color: #d58512;
  border-color: #985f0d;
}
.notification_widget.warning:active,
.notification_widget.warning.active,
.open > .dropdown-toggle.notification_widget.warning {
  background-image: none;
}
.notification_widget.warning.disabled:hover,
.notification_widget.warning[disabled]:hover,
fieldset[disabled] .notification_widget.warning:hover,
.notification_widget.warning.disabled:focus,
.notification_widget.warning[disabled]:focus,
fieldset[disabled] .notification_widget.warning:focus,
.notification_widget.warning.disabled.focus,
.notification_widget.warning[disabled].focus,
fieldset[disabled] .notification_widget.warning.focus {
  background-color: #f0ad4e;
  border-color: #eea236;
}
.notification_widget.warning .badge {
  color: #f0ad4e;
  background-color: #fff;
}
.notification_widget.success {
  color: #fff;
  background-color: #5cb85c;
  border-color: #4cae4c;
}
.notification_widget.success:focus,
.notification_widget.success.focus {
  color: #fff;
  background-color: #449d44;
  border-color: #255625;
}
.notification_widget.success:hover {
  color: #fff;
  background-color: #449d44;
  border-color: #398439;
}
.notification_widget.success:active,
.notification_widget.success.active,
.open > .dropdown-toggle.notification_widget.success {
  color: #fff;
  background-color: #449d44;
  border-color: #398439;
}
.notification_widget.success:active:hover,
.notification_widget.success.active:hover,
.open > .dropdown-toggle.notification_widget.success:hover,
.notification_widget.success:active:focus,
.notification_widget.success.active:focus,
.open > .dropdown-toggle.notification_widget.success:focus,
.notification_widget.success:active.focus,
.notification_widget.success.active.focus,
.open > .dropdown-toggle.notification_widget.success.focus {
  color: #fff;
  background-color: #398439;
  border-color: #255625;
}
.notification_widget.success:active,
.notification_widget.success.active,
.open > .dropdown-toggle.notification_widget.success {
  background-image: none;
}
.notification_widget.success.disabled:hover,
.notification_widget.success[disabled]:hover,
fieldset[disabled] .notification_widget.success:hover,
.notification_widget.success.disabled:focus,
.notification_widget.success[disabled]:focus,
fieldset[disabled] .notification_widget.success:focus,
.notification_widget.success.disabled.focus,
.notification_widget.success[disabled].focus,
fieldset[disabled] .notification_widget.success.focus {
  background-color: #5cb85c;
  border-color: #4cae4c;
}
.notification_widget.success .badge {
  color: #5cb85c;
  background-color: #fff;
}
.notification_widget.info {
  color: #fff;
  background-color: #5bc0de;
  border-color: #46b8da;
}
.notification_widget.info:focus,
.notification_widget.info.focus {
  color: #fff;
  background-color: #31b0d5;
  border-color: #1b6d85;
}
.notification_widget.info:hover {
  color: #fff;
  background-color: #31b0d5;
  border-color: #269abc;
}
.notification_widget.info:active,
.notification_widget.info.active,
.open > .dropdown-toggle.notification_widget.info {
  color: #fff;
  background-color: #31b0d5;
  border-color: #269abc;
}
.notification_widget.info:active:hover,
.notification_widget.info.active:hover,
.open > .dropdown-toggle.notification_widget.info:hover,
.notification_widget.info:active:focus,
.notification_widget.info.active:focus,
.open > .dropdown-toggle.notification_widget.info:focus,
.notification_widget.info:active.focus,
.notification_widget.info.active.focus,
.open > .dropdown-toggle.notification_widget.info.focus {
  color: #fff;
  background-color: #269abc;
  border-color: #1b6d85;
}
.notification_widget.info:active,
.notification_widget.info.active,
.open > .dropdown-toggle.notification_widget.info {
  background-image: none;
}
.notification_widget.info.disabled:hover,
.notification_widget.info[disabled]:hover,
fieldset[disabled] .notification_widget.info:hover,
.notification_widget.info.disabled:focus,
.notification_widget.info[disabled]:focus,
fieldset[disabled] .notification_widget.info:focus,
.notification_widget.info.disabled.focus,
.notification_widget.info[disabled].focus,
fieldset[disabled] .notification_widget.info.focus {
  background-color: #5bc0de;
  border-color: #46b8da;
}
.notification_widget.info .badge {
  color: #5bc0de;
  background-color: #fff;
}
.notification_widget.danger {
  color: #fff;
  background-color: #d9534f;
  border-color: #d43f3a;
}
.notification_widget.danger:focus,
.notification_widget.danger.focus {
  color: #fff;
  background-color: #c9302c;
  border-color: #761c19;
}
.notification_widget.danger:hover {
  color: #fff;
  background-color: #c9302c;
  border-color: #ac2925;
}
.notification_widget.danger:active,
.notification_widget.danger.active,
.open > .dropdown-toggle.notification_widget.danger {
  color: #fff;
  background-color: #c9302c;
  border-color: #ac2925;
}
.notification_widget.danger:active:hover,
.notification_widget.danger.active:hover,
.open > .dropdown-toggle.notification_widget.danger:hover,
.notification_widget.danger:active:focus,
.notification_widget.danger.active:focus,
.open > .dropdown-toggle.notification_widget.danger:focus,
.notification_widget.danger:active.focus,
.notification_widget.danger.active.focus,
.open > .dropdown-toggle.notification_widget.danger.focus {
  color: #fff;
  background-color: #ac2925;
  border-color: #761c19;
}
.notification_widget.danger:active,
.notification_widget.danger.active,
.open > .dropdown-toggle.notification_widget.danger {
  background-image: none;
}
.notification_widget.danger.disabled:hover,
.notification_widget.danger[disabled]:hover,
fieldset[disabled] .notification_widget.danger:hover,
.notification_widget.danger.disabled:focus,
.notification_widget.danger[disabled]:focus,
fieldset[disabled] .notification_widget.danger:focus,
.notification_widget.danger.disabled.focus,
.notification_widget.danger[disabled].focus,
fieldset[disabled] .notification_widget.danger.focus {
  background-color: #d9534f;
  border-color: #d43f3a;
}
.notification_widget.danger .badge {
  color: #d9534f;
  background-color: #fff;
}
div#pager {
  background-color: #fff;
  font-size: 14px;
  line-height: 20px;
  overflow: hidden;
  display: none;
  position: fixed;
  bottom: 0px;
  width: 100%;
  max-height: 50%;
  padding-top: 8px;
  -webkit-box-shadow: 0px 0px 12px 1px rgba(87, 87, 87, 0.2);
  box-shadow: 0px 0px 12px 1px rgba(87, 87, 87, 0.2);
  /* Display over codemirror */
  z-index: 100;
  /* Hack which prevents jquery ui resizable from changing top. */
  top: auto !important;
}
div#pager pre {
  line-height: 1.21429em;
  color: #000;
  background-color: #f7f7f7;
  padding: 0.4em;
}
div#pager #pager-button-area {
  position: absolute;
  top: 8px;
  right: 20px;
}
div#pager #pager-contents {
  position: relative;
  overflow: auto;
  width: 100%;
  height: 100%;
}
div#pager #pager-contents #pager-container {
  position: relative;
  padding: 15px 0px;
  box-sizing: border-box;
  -moz-box-sizing: border-box;
  -webkit-box-sizing: border-box;
}
div#pager .ui-resizable-handle {
  top: 0px;
  height: 8px;
  background: #f7f7f7;
  border-top: 1px solid #cfcfcf;
  border-bottom: 1px solid #cfcfcf;
  /* This injects handle bars (a short, wide = symbol) for 
        the resize handle. */
}
div#pager .ui-resizable-handle::after {
  content: '';
  top: 2px;
  left: 50%;
  height: 3px;
  width: 30px;
  margin-left: -15px;
  position: absolute;
  border-top: 1px solid #cfcfcf;
}
.quickhelp {
  /* Old browsers */
  display: -webkit-box;
  -webkit-box-orient: horizontal;
  -webkit-box-align: stretch;
  display: -moz-box;
  -moz-box-orient: horizontal;
  -moz-box-align: stretch;
  display: box;
  box-orient: horizontal;
  box-align: stretch;
  /* Modern browsers */
  display: flex;
  flex-direction: row;
  align-items: stretch;
  line-height: 1.8em;
}
.shortcut_key {
  display: inline-block;
  width: 20ex;
  text-align: right;
  font-family: monospace;
}
.shortcut_descr {
  display: inline-block;
  /* Old browsers */
  -webkit-box-flex: 1;
  -moz-box-flex: 1;
  box-flex: 1;
  /* Modern browsers */
  flex: 1;
}
span.save_widget {
  margin-top: 6px;
}
span.save_widget span.filename {
  height: 1em;
  line-height: 1em;
  padding: 3px;
  margin-left: 16px;
  border: none;
  font-size: 146.5%;
  border-radius: 2px;
}
span.save_widget span.filename:hover {
  background-color: #e6e6e6;
}
span.checkpoint_status,
span.autosave_status {
  font-size: small;
}
@media (max-width: 767px) {
  span.save_widget {
    font-size: small;
  }
  span.checkpoint_status,
  span.autosave_status {
    display: none;
  }
}
@media (min-width: 768px) and (max-width: 991px) {
  span.checkpoint_status {
    display: none;
  }
  span.autosave_status {
    font-size: x-small;
  }
}
.toolbar {
  padding: 0px;
  margin-left: -5px;
  margin-top: 2px;
  margin-bottom: 5px;
  box-sizing: border-box;
  -moz-box-sizing: border-box;
  -webkit-box-sizing: border-box;
}
.toolbar select,
.toolbar label {
  width: auto;
  vertical-align: middle;
  margin-right: 2px;
  margin-bottom: 0px;
  display: inline;
  font-size: 92%;
  margin-left: 0.3em;
  margin-right: 0.3em;
  padding: 0px;
  padding-top: 3px;
}
.toolbar .btn {
  padding: 2px 8px;
}
.toolbar .btn-group {
  margin-top: 0px;
  margin-left: 5px;
}
#maintoolbar {
  margin-bottom: -3px;
  margin-top: -8px;
  border: 0px;
  min-height: 27px;
  margin-left: 0px;
  padding-top: 11px;
  padding-bottom: 3px;
}
#maintoolbar .navbar-text {
  float: none;
  vertical-align: middle;
  text-align: right;
  margin-left: 5px;
  margin-right: 0px;
  margin-top: 0px;
}
.select-xs {
  height: 24px;
}
.pulse,
.dropdown-menu > li > a.pulse,
li.pulse > a.dropdown-toggle,
li.pulse.open > a.dropdown-toggle {
  background-color: #F37626;
  color: white;
}
/**
 * Primary styles
 *
 * Author: Jupyter Development Team
 */
/** WARNING IF YOU ARE EDITTING THIS FILE, if this is a .css file, It has a lot
 * of chance of beeing generated from the ../less/[samename].less file, you can
 * try to get back the less file by reverting somme commit in history
 **/
/*
 * We'll try to get something pretty, so we
 * have some strange css to have the scroll bar on
 * the left with fix button on the top right of the tooltip
 */
@-moz-keyframes fadeOut {
  from {
    opacity: 1;
  }
  to {
    opacity: 0;
  }
}
@-webkit-keyframes fadeOut {
  from {
    opacity: 1;
  }
  to {
    opacity: 0;
  }
}
@-moz-keyframes fadeIn {
  from {
    opacity: 0;
  }
  to {
    opacity: 1;
  }
}
@-webkit-keyframes fadeIn {
  from {
    opacity: 0;
  }
  to {
    opacity: 1;
  }
}
/*properties of tooltip after "expand"*/
.bigtooltip {
  overflow: auto;
  height: 200px;
  -webkit-transition-property: height;
  -webkit-transition-duration: 500ms;
  -moz-transition-property: height;
  -moz-transition-duration: 500ms;
  transition-property: height;
  transition-duration: 500ms;
}
/*properties of tooltip before "expand"*/
.smalltooltip {
  -webkit-transition-property: height;
  -webkit-transition-duration: 500ms;
  -moz-transition-property: height;
  -moz-transition-duration: 500ms;
  transition-property: height;
  transition-duration: 500ms;
  text-overflow: ellipsis;
  overflow: hidden;
  height: 80px;
}
.tooltipbuttons {
  position: absolute;
  padding-right: 15px;
  top: 0px;
  right: 0px;
}
.tooltiptext {
  /*avoid the button to overlap on some docstring*/
  padding-right: 30px;
}
.ipython_tooltip {
  max-width: 700px;
  /*fade-in animation when inserted*/
  -webkit-animation: fadeOut 400ms;
  -moz-animation: fadeOut 400ms;
  animation: fadeOut 400ms;
  -webkit-animation: fadeIn 400ms;
  -moz-animation: fadeIn 400ms;
  animation: fadeIn 400ms;
  vertical-align: middle;
  background-color: #f7f7f7;
  overflow: visible;
  border: #ababab 1px solid;
  outline: none;
  padding: 3px;
  margin: 0px;
  padding-left: 7px;
  font-family: monospace;
  min-height: 50px;
  -moz-box-shadow: 0px 6px 10px -1px #adadad;
  -webkit-box-shadow: 0px 6px 10px -1px #adadad;
  box-shadow: 0px 6px 10px -1px #adadad;
  border-radius: 2px;
  position: absolute;
  z-index: 1000;
}
.ipython_tooltip a {
  float: right;
}
.ipython_tooltip .tooltiptext pre {
  border: 0;
  border-radius: 0;
  font-size: 100%;
  background-color: #f7f7f7;
}
.pretooltiparrow {
  left: 0px;
  margin: 0px;
  top: -16px;
  width: 40px;
  height: 16px;
  overflow: hidden;
  position: absolute;
}
.pretooltiparrow:before {
  background-color: #f7f7f7;
  border: 1px #ababab solid;
  z-index: 11;
  content: "";
  position: absolute;
  left: 15px;
  top: 10px;
  width: 25px;
  height: 25px;
  -webkit-transform: rotate(45deg);
  -moz-transform: rotate(45deg);
  -ms-transform: rotate(45deg);
  -o-transform: rotate(45deg);
}
ul.typeahead-list i {
  margin-left: -10px;
  width: 18px;
}
ul.typeahead-list {
  max-height: 80vh;
  overflow: auto;
}
ul.typeahead-list > li > a {
  /** Firefox bug **/
  /* see https://github.com/jupyter/notebook/issues/559 */
  white-space: normal;
}
.cmd-palette .modal-body {
  padding: 7px;
}
.cmd-palette form {
  background: white;
}
.cmd-palette input {
  outline: none;
}
.no-shortcut {
  display: none;
}
.command-shortcut:before {
  content: "(command)";
  padding-right: 3px;
  color: #777777;
}
.edit-shortcut:before {
  content: "(edit)";
  padding-right: 3px;
  color: #777777;
}
#find-and-replace #replace-preview .match,
#find-and-replace #replace-preview .insert {
  background-color: #BBDEFB;
  border-color: #90CAF9;
  border-style: solid;
  border-width: 1px;
  border-radius: 0px;
}
#find-and-replace #replace-preview .replace .match {
  background-color: #FFCDD2;
  border-color: #EF9A9A;
  border-radius: 0px;
}
#find-and-replace #replace-preview .replace .insert {
  background-color: #C8E6C9;
  border-color: #A5D6A7;
  border-radius: 0px;
}
#find-and-replace #replace-preview {
  max-height: 60vh;
  overflow: auto;
}
#find-and-replace #replace-preview pre {
  padding: 5px 10px;
}
.terminal-app {
  background: #EEE;
}
.terminal-app #header {
  background: #fff;
  -webkit-box-shadow: 0px 0px 12px 1px rgba(87, 87, 87, 0.2);
  box-shadow: 0px 0px 12px 1px rgba(87, 87, 87, 0.2);
}
.terminal-app .terminal {
  float: left;
  font-family: monospace;
  color: white;
  background: black;
  padding: 0.4em;
  border-radius: 2px;
  -webkit-box-shadow: 0px 0px 12px 1px rgba(87, 87, 87, 0.4);
  box-shadow: 0px 0px 12px 1px rgba(87, 87, 87, 0.4);
}
.terminal-app .terminal,
.terminal-app .terminal dummy-screen {
  line-height: 1em;
  font-size: 14px;
}
.terminal-app .terminal-cursor {
  color: black;
  background: white;
}
.terminal-app #terminado-container {
  margin-top: 20px;
}
/*# sourceMappingURL=style.min.css.map */
    </style>
<style type="text/css">
    .highlight .hll { background-color: #ffffcc }
.highlight  { background: #f8f8f8; }
.highlight .c { color: #408080; font-style: italic } /* Comment */
.highlight .err { border: 1px solid #FF0000 } /* Error */
.highlight .k { color: #008000; font-weight: bold } /* Keyword */
.highlight .o { color: #666666 } /* Operator */
.highlight .ch { color: #408080; font-style: italic } /* Comment.Hashbang */
.highlight .cm { color: #408080; font-style: italic } /* Comment.Multiline */
.highlight .cp { color: #BC7A00 } /* Comment.Preproc */
.highlight .cpf { color: #408080; font-style: italic } /* Comment.PreprocFile */
.highlight .c1 { color: #408080; font-style: italic } /* Comment.Single */
.highlight .cs { color: #408080; font-style: italic } /* Comment.Special */
.highlight .gd { color: #A00000 } /* Generic.Deleted */
.highlight .ge { font-style: italic } /* Generic.Emph */
.highlight .gr { color: #FF0000 } /* Generic.Error */
.highlight .gh { color: #000080; font-weight: bold } /* Generic.Heading */
.highlight .gi { color: #00A000 } /* Generic.Inserted */
.highlight .go { color: #888888 } /* Generic.Output */
.highlight .gp { color: #000080; font-weight: bold } /* Generic.Prompt */
.highlight .gs { font-weight: bold } /* Generic.Strong */
.highlight .gu { color: #800080; font-weight: bold } /* Generic.Subheading */
.highlight .gt { color: #0044DD } /* Generic.Traceback */
.highlight .kc { color: #008000; font-weight: bold } /* Keyword.Constant */
.highlight .kd { color: #008000; font-weight: bold } /* Keyword.Declaration */
.highlight .kn { color: #008000; font-weight: bold } /* Keyword.Namespace */
.highlight .kp { color: #008000 } /* Keyword.Pseudo */
.highlight .kr { color: #008000; font-weight: bold } /* Keyword.Reserved */
.highlight .kt { color: #B00040 } /* Keyword.Type */
.highlight .m { color: #666666 } /* Literal.Number */
.highlight .s { color: #BA2121 } /* Literal.String */
.highlight .na { color: #7D9029 } /* Name.Attribute */
.highlight .nb { color: #008000 } /* Name.Builtin */
.highlight .nc { color: #0000FF; font-weight: bold } /* Name.Class */
.highlight .no { color: #880000 } /* Name.Constant */
.highlight .nd { color: #AA22FF } /* Name.Decorator */
.highlight .ni { color: #999999; font-weight: bold } /* Name.Entity */
.highlight .ne { color: #D2413A; font-weight: bold } /* Name.Exception */
.highlight .nf { color: #0000FF } /* Name.Function */
.highlight .nl { color: #A0A000 } /* Name.Label */
.highlight .nn { color: #0000FF; font-weight: bold } /* Name.Namespace */
.highlight .nt { color: #008000; font-weight: bold } /* Name.Tag */
.highlight .nv { color: #19177C } /* Name.Variable */
.highlight .ow { color: #AA22FF; font-weight: bold } /* Operator.Word */
.highlight .w { color: #bbbbbb } /* Text.Whitespace */
.highlight .mb { color: #666666 } /* Literal.Number.Bin */
.highlight .mf { color: #666666 } /* Literal.Number.Float */
.highlight .mh { color: #666666 } /* Literal.Number.Hex */
.highlight .mi { color: #666666 } /* Literal.Number.Integer */
.highlight .mo { color: #666666 } /* Literal.Number.Oct */
.highlight .sb { color: #BA2121 } /* Literal.String.Backtick */
.highlight .sc { color: #BA2121 } /* Literal.String.Char */
.highlight .sd { color: #BA2121; font-style: italic } /* Literal.String.Doc */
.highlight .s2 { color: #BA2121 } /* Literal.String.Double */
.highlight .se { color: #BB6622; font-weight: bold } /* Literal.String.Escape */
.highlight .sh { color: #BA2121 } /* Literal.String.Heredoc */
.highlight .si { color: #BB6688; font-weight: bold } /* Literal.String.Interpol */
.highlight .sx { color: #008000 } /* Literal.String.Other */
.highlight .sr { color: #BB6688 } /* Literal.String.Regex */
.highlight .s1 { color: #BA2121 } /* Literal.String.Single */
.highlight .ss { color: #19177C } /* Literal.String.Symbol */
.highlight .bp { color: #008000 } /* Name.Builtin.Pseudo */
.highlight .vc { color: #19177C } /* Name.Variable.Class */
.highlight .vg { color: #19177C } /* Name.Variable.Global */
.highlight .vi { color: #19177C } /* Name.Variable.Instance */
.highlight .il { color: #666666 } /* Literal.Number.Integer.Long */
    </style>
<style type="text/css">
    
/* Temporary definitions which will become obsolete with Notebook release 5.0 */
.ansi-black-fg { color: #3E424D; }
.ansi-black-bg { background-color: #3E424D; }
.ansi-black-intense-fg { color: #282C36; }
.ansi-black-intense-bg { background-color: #282C36; }
.ansi-red-fg { color: #E75C58; }
.ansi-red-bg { background-color: #E75C58; }
.ansi-red-intense-fg { color: #B22B31; }
.ansi-red-intense-bg { background-color: #B22B31; }
.ansi-green-fg { color: #00A250; }
.ansi-green-bg { background-color: #00A250; }
.ansi-green-intense-fg { color: #007427; }
.ansi-green-intense-bg { background-color: #007427; }
.ansi-yellow-fg { color: #DDB62B; }
.ansi-yellow-bg { background-color: #DDB62B; }
.ansi-yellow-intense-fg { color: #B27D12; }
.ansi-yellow-intense-bg { background-color: #B27D12; }
.ansi-blue-fg { color: #208FFB; }
.ansi-blue-bg { background-color: #208FFB; }
.ansi-blue-intense-fg { color: #0065CA; }
.ansi-blue-intense-bg { background-color: #0065CA; }
.ansi-magenta-fg { color: #D160C4; }
.ansi-magenta-bg { background-color: #D160C4; }
.ansi-magenta-intense-fg { color: #A03196; }
.ansi-magenta-intense-bg { background-color: #A03196; }
.ansi-cyan-fg { color: #60C6C8; }
.ansi-cyan-bg { background-color: #60C6C8; }
.ansi-cyan-intense-fg { color: #258F8F; }
.ansi-cyan-intense-bg { background-color: #258F8F; }
.ansi-white-fg { color: #C5C1B4; }
.ansi-white-bg { background-color: #C5C1B4; }
.ansi-white-intense-fg { color: #A1A6B2; }
.ansi-white-intense-bg { background-color: #A1A6B2; }

.ansi-bold { font-weight: bold; }

    </style>


<style type="text/css">
/* Overrides of notebook CSS for static HTML export */
body {
  overflow: visible;
  padding: 8px;
}

div#notebook {
  overflow: visible;
  border-top: none;
}

@media print {
  div.cell {
    display: block;
    page-break-inside: avoid;
  } 
  div.output_wrapper { 
    display: block;
    page-break-inside: avoid; 
  }
  div.output { 
    display: block;
    page-break-inside: avoid; 
  }
}
</style>

<!-- Custom stylesheet, it must be in the same directory as the html file -->
<link rel="stylesheet" href="custom.css">

<!-- Loading mathjax macro -->
<!-- Load mathjax -->
    <script src="https://cdn.mathjax.org/mathjax/latest/MathJax.js?config=TeX-AMS_HTML"></script>
    <!-- MathJax configuration -->
    <script type="text/x-mathjax-config">
    MathJax.Hub.Config({
        tex2jax: {
            inlineMath: [ ['$','$'], ["\\(","\\)"] ],
            displayMath: [ ['$$','$$'], ["\\[","\\]"] ],
            processEscapes: true,
            processEnvironments: true
        },
        // Center justify equations in code and markdown cells. Elsewhere
        // we use CSS to left justify single line equations in code cells.
        displayAlign: 'center',
        "HTML-CSS": {
            styles: {'.MathJax_Display': {"margin": 0}},
            linebreaks: { automatic: true }
        }
    });
    </script>
    <!-- End of mathjax configuration --></head>
<body>
  <div tabindex="-1" id="notebook" class="border-box-sizing">
    <div class="container" id="notebook-container">

<div class="cell border-box-sizing code_cell rendered">
<div class="input">
<div class="prompt input_prompt">In&nbsp;[430]:</div>
<div class="inner_cell">
    <div class="input_area">
<div class=" highlight hl-ipython3"><pre><span></span><span class="kn">import</span> <span class="nn">biom</span>
<span class="kn">import</span> <span class="nn">sklearn</span>
<span class="kn">import</span> <span class="nn">pandas</span> <span class="k">as</span> <span class="nn">pd</span>
</pre></div>

</div>
</div>
</div>

</div>
<div class="cell border-box-sizing code_cell rendered">
<div class="input">
<div class="prompt input_prompt">In&nbsp;[431]:</div>
<div class="inner_cell">
    <div class="input_area">
<div class=" highlight hl-ipython3"><pre><span></span><span class="n">m</span> <span class="o">=</span> <span class="n">pd</span><span class="o">.</span><span class="n">read_csv</span><span class="p">(</span><span class="s2">&quot;/Users/shwetakinger/Downloads/Metadata_new.txt&quot;</span><span class="p">,</span> <span class="n">sep</span><span class="o">=</span><span class="s2">&quot;</span><span class="se">\t</span><span class="s2">&quot;</span><span class="p">,</span> <span class="n">index_col</span><span class="o">=</span><span class="mi">0</span><span class="p">)</span>
</pre></div>

</div>
</div>
</div>

</div>
<div class="cell border-box-sizing code_cell rendered">
<div class="input">
<div class="prompt input_prompt">In&nbsp;[432]:</div>
<div class="inner_cell">
    <div class="input_area">
<div class=" highlight hl-ipython3"><pre><span></span><span class="n">m</span><span class="o">.</span><span class="n">columns</span>
</pre></div>

</div>
</div>
</div>

<div class="output_wrapper">
<div class="output">


<div class="output_area"><div class="prompt output_prompt">Out[432]:</div>


<div class="output_text output_subarea output_execute_result">
<pre>Index([&#39;BarcodeSequence&#39;, &#39;LinkerPrimerSequence&#39;, &#39;center_name&#39;,
       &#39;center_project_name&#39;, &#39;experiment_design_description&#39;,
       &#39;instrument_model&#39;, &#39;library_construction_protocol&#39;, &#39;linker&#39;,
       &#39;platform&#39;, &#39;run_center&#39;, &#39;run_date&#39;, &#39;run_prefix&#39;, &#39;sequencing_meth&#39;,
       &#39;target_gene&#39;, &#39;target_subfragment&#39;, &#39;body_habitat&#39;, &#39;body_product&#39;,
       &#39;body_site&#39;, &#39;collection_timestamp&#39;, &#39;diabetes&#39;, &#39;dna_extracted&#39;, &#39;dol&#39;,
       &#39;donor_recipient&#39;, &#39;elevation&#39;, &#39;env_biome&#39;, &#39;env_feature&#39;,
       &#39;env_material&#39;, &#39;env_package&#39;, &#39;experiment&#39;, &#39;geo_loc_name&#39;,
       &#39;host_scientific_name&#39;, &#39;host_subject_id&#39;, &#39;host_taxid&#39;, &#39;latitude&#39;,
       &#39;longitude&#39;, &#39;physical_specimen_location&#39;,
       &#39;physical_specimen_remaining&#39;, &#39;sample_type&#39;, &#39;scientific_name&#39;, &#39;sex&#39;,
       &#39;title&#39;, &#39;treatment&#39;, &#39;week&#39;, &#39;Description&#39;],
      dtype=&#39;object&#39;)</pre>
</div>

</div>

</div>
</div>

</div>
<div class="cell border-box-sizing code_cell rendered">
<div class="input">
<div class="prompt input_prompt">In&nbsp;[475]:</div>
<div class="inner_cell">
    <div class="input_area">
<div class=" highlight hl-ipython3"><pre><span></span><span class="n">i</span> <span class="o">=</span> <span class="n">m</span><span class="p">[</span><span class="n">m</span><span class="o">.</span><span class="n">treatment</span><span class="o">==</span><span class="s2">&quot;PAT&quot;</span><span class="p">][</span><span class="n">m</span><span class="o">.</span><span class="n">sex</span><span class="o">==</span><span class="s2">&quot;male&quot;</span><span class="p">]</span> <span class="p">[[</span><span class="s2">&quot;treatment&quot;</span><span class="p">,</span> <span class="s2">&quot;sex&quot;</span><span class="p">,</span> <span class="s2">&quot;diabetes&quot;</span><span class="p">]]</span><span class="o">.</span><span class="n">index</span>
<span class="nb">print</span><span class="p">(</span><span class="n">i</span><span class="p">)</span>
<span class="c1">#i_2 = m[m.treatment==&quot;PAT&quot;][m.sex==&quot;male&quot;][m.body_site==&quot;UBERON:feces&quot;][[&quot;treatment&quot;, &quot;body_site&quot;, &quot;sex&quot;, &quot;diabetes&quot;]]</span>

<span class="n">i_2</span> <span class="o">=</span> <span class="n">m</span><span class="p">[</span><span class="n">m</span><span class="o">.</span><span class="n">treatment</span><span class="o">==</span><span class="s2">&quot;PAT&quot;</span><span class="p">][</span><span class="n">m</span><span class="o">.</span><span class="n">sex</span><span class="o">==</span><span class="s2">&quot;male&quot;</span><span class="p">]</span> <span class="p">[[</span><span class="s2">&quot;treatment&quot;</span><span class="p">,</span> <span class="s2">&quot;sex&quot;</span><span class="p">,</span> <span class="s2">&quot;diabetes&quot;</span><span class="p">]]</span>
<span class="c1">#print(i_2)</span>
</pre></div>

</div>
</div>
</div>

<div class="output_wrapper">
<div class="output">


<div class="output_area"><div class="prompt"></div>
<div class="output_subarea output_stream output_stdout output_text">
<pre>Index([&#39;10508.BP13.3.fec&#39;, &#39;10508.BP14.3.fec&#39;, &#39;10508.BP15.3.fec&#39;,
       &#39;10508.BP16.3.fec&#39;, &#39;10508.BP17.3.fec&#39;, &#39;10508.BP18.3.fec&#39;,
       &#39;10508.BP53.3.fec&#39;, &#39;10508.BP54.3.fec&#39;, &#39;10508.BP55.3.fec&#39;,
       &#39;10508.BP56.3.fec&#39;, &#39;10508.BP57.3.fec&#39;, &#39;10508.BP67.3.fec&#39;,
       &#39;10508.BP69.3.fec&#39;, &#39;10508.BP70.3.fec&#39;, &#39;10508.BP71.3.fec&#39;,
       &#39;10508.BP124.3.fec&#39;, &#39;10508.BP126.3.fec&#39;, &#39;10508.BP127.3.fec&#39;,
       &#39;10508.BP128.3.fec&#39;, &#39;10508.BP131.3.fec&#39;, &#39;10508.BP132.3.fec&#39;,
       &#39;10508.BP133.3.fec&#39;, &#39;10508.BP134.3.fec&#39;, &#39;10508.BP138.3.fec&#39;,
       &#39;10508.BP13.6.fec&#39;, &#39;10508.BP14.6.fec&#39;, &#39;10508.BP15.6.fec&#39;,
       &#39;10508.BP16.6.fec&#39;, &#39;10508.BP17.6.fec&#39;, &#39;10508.BP18.6.fec&#39;,
       &#39;10508.BP53.6.fec&#39;, &#39;10508.BP54.6.fec&#39;, &#39;10508.BP55.6.fec&#39;,
       &#39;10508.BP56.6.fec&#39;, &#39;10508.BP57.6.fec&#39;, &#39;10508.BP67.6.fec&#39;,
       &#39;10508.BP69.6.fec&#39;, &#39;10508.BP70.6.fec&#39;, &#39;10508.BP71.6.fec&#39;,
       &#39;10508.BP124.6.fec&#39;, &#39;10508.BP126.6.fec&#39;, &#39;10508.BP127.6.fec&#39;,
       &#39;10508.BP128.6.fec&#39;, &#39;10508.BP131.6.fec&#39;, &#39;10508.BP132.6.fec&#39;,
       &#39;10508.BP133.6.fec&#39;, &#39;10508.BP134.6.fec&#39;, &#39;10508.BP138.6.fec&#39;,
       &#39;10508.BP13.10.fec&#39;, &#39;10508.BP14.10.fec&#39;, &#39;10508.BP15.10.fec&#39;,
       &#39;10508.BP16.10.fec&#39;, &#39;10508.BP17.10.fec&#39;, &#39;10508.BP18.10.fec&#39;,
       &#39;10508.BP53.10.fec&#39;, &#39;10508.BP54.10.fec&#39;, &#39;10508.BP55.10.fec&#39;,
       &#39;10508.BP56.10.fec&#39;, &#39;10508.BP57.10.fec&#39;, &#39;10508.BP67.10.fec&#39;,
       &#39;10508.BP69.10.fec&#39;, &#39;10508.BP70.10.fec&#39;, &#39;10508.BP71.10.fec&#39;,
       &#39;10508.BP131.10.fec&#39;, &#39;10508.BP132.10.fec&#39;, &#39;10508.BP133.10.fec&#39;,
       &#39;10508.BP134.10.fec&#39;, &#39;10508.BP13.13.fec&#39;, &#39;10508.BP14.13.fec&#39;,
       &#39;10508.BP15.13.fec&#39;, &#39;10508.BP16.13.fec&#39;, &#39;10508.BP17.13.fec&#39;,
       &#39;10508.BP18.13.fec&#39;, &#39;10508.BP53.13.fec&#39;, &#39;10508.BP54.13.fec&#39;,
       &#39;10508.BP55.13.fec&#39;, &#39;10508.BP56.13.fec&#39;, &#39;10508.BP57.13.fec&#39;,
       &#39;10508.BP67.13.fec&#39;, &#39;10508.BP69.13.fec&#39;, &#39;10508.BP70.13.fec&#39;,
       &#39;10508.BP71.13.fec&#39;, &#39;10508.BP131.13.fec&#39;, &#39;10508.BP132.13.fec&#39;,
       &#39;10508.BP133.13.fec&#39;, &#39;10508.BP134.13.fec&#39;, &#39;10508.BP124.6.cec&#39;,
       &#39;10508.BP126.6.cec&#39;, &#39;10508.BP127.6.cec&#39;, &#39;10508.BP128.6.cec&#39;,
       &#39;10508.BP138.6.cec&#39;, &#39;10508.BP124.6.ile&#39;, &#39;10508.BP126.6.ile&#39;,
       &#39;10508.BP127.6.ile&#39;, &#39;10508.BP128.6.ile&#39;, &#39;10508.BP138.6.ile&#39;],
      dtype=&#39;object&#39;, name=&#39;#SampleID&#39;)
</pre>
</div>
</div>

<div class="output_area"><div class="prompt"></div>
<div class="output_subarea output_stream output_stderr output_text">
<pre>/Users/shwetakinger/anaconda/lib/python3.5/site-packages/ipykernel/__main__.py:1: UserWarning: Boolean Series key will be reindexed to match DataFrame index.
  if __name__ == &#39;__main__&#39;:
/Users/shwetakinger/anaconda/lib/python3.5/site-packages/ipykernel/__main__.py:5: UserWarning: Boolean Series key will be reindexed to match DataFrame index.
</pre>
</div>
</div>

</div>
</div>

</div>
<div class="cell border-box-sizing code_cell rendered">
<div class="input">
<div class="prompt input_prompt">In&nbsp;[476]:</div>
<div class="inner_cell">
    <div class="input_area">
<div class=" highlight hl-ipython3"><pre><span></span><span class="n">b</span><span class="o">=</span> <span class="n">biom</span><span class="o">.</span><span class="n">load_table</span><span class="p">(</span><span class="s2">&quot;/Users/shwetakinger/Downloads/final.only-16s_new.biom&quot;</span><span class="p">)</span>
</pre></div>

</div>
</div>
</div>

</div>
<div class="cell border-box-sizing code_cell rendered">
<div class="input">
<div class="prompt input_prompt">In&nbsp;[477]:</div>
<div class="inner_cell">
    <div class="input_area">
<div class=" highlight hl-ipython3"><pre><span></span><span class="n">p</span> <span class="o">=</span> <span class="n">pd</span><span class="o">.</span><span class="n">DataFrame</span><span class="p">(</span><span class="n">b</span><span class="o">.</span><span class="n">matrix_data</span><span class="o">.</span><span class="n">T</span><span class="o">.</span><span class="n">todense</span><span class="p">()</span><span class="o">.</span><span class="n">astype</span><span class="p">(</span><span class="nb">int</span><span class="p">),</span> <span class="n">index</span><span class="o">=</span><span class="n">b</span><span class="o">.</span><span class="n">ids</span><span class="p">(</span><span class="n">axis</span><span class="o">=</span><span class="s2">&quot;sample&quot;</span><span class="p">),</span> <span class="n">columns</span><span class="o">=</span><span class="n">b</span><span class="o">.</span><span class="n">ids</span><span class="p">(</span><span class="n">axis</span><span class="o">=</span><span class="s2">&quot;observation&quot;</span><span class="p">))</span>
</pre></div>

</div>
</div>
</div>

</div>
<div class="cell border-box-sizing code_cell rendered">
<div class="input">
<div class="prompt input_prompt">In&nbsp;[478]:</div>
<div class="inner_cell">
    <div class="input_area">
<div class=" highlight hl-ipython3"><pre><span></span><span class="n">c</span> <span class="o">=</span> <span class="n">p</span><span class="o">.</span><span class="n">loc</span><span class="p">[</span><span class="n">i</span><span class="p">,:]</span>
<span class="nb">print</span><span class="p">(</span><span class="n">c</span><span class="p">)</span>
</pre></div>

</div>
</div>
</div>

<div class="output_wrapper">
<div class="output">


<div class="output_area"><div class="prompt"></div>
<div class="output_subarea output_stream output_stdout output_text">
<pre>                    TACGGAGGATGCGAGCGTTATCCGGATTTATTGGGTTTAAAGGGTGCGCAGGCGGTCTGTTAAGTCAGCGGTCAAAGCCCGGGGCTCAAC  \
#SampleID                                                                                                        
10508.BP13.3.fec                                                    2                                            
10508.BP14.3.fec                                                    0                                            
10508.BP15.3.fec                                                    0                                            
10508.BP16.3.fec                                                    0                                            
10508.BP17.3.fec                                                    0                                            
10508.BP18.3.fec                                                    0                                            
10508.BP53.3.fec                                                    0                                            
10508.BP54.3.fec                                                    0                                            
10508.BP55.3.fec                                                    0                                            
10508.BP56.3.fec                                                    2                                            
10508.BP57.3.fec                                                    0                                            
10508.BP67.3.fec                                                    0                                            
10508.BP69.3.fec                                                    0                                            
10508.BP70.3.fec                                                    0                                            
10508.BP71.3.fec                                                    0                                            
10508.BP124.3.fec                                                   0                                            
10508.BP126.3.fec                                                   0                                            
10508.BP127.3.fec                                                   0                                            
10508.BP128.3.fec                                                   0                                            
10508.BP131.3.fec                                                   0                                            
10508.BP132.3.fec                                                   0                                            
10508.BP133.3.fec                                                   2                                            
10508.BP134.3.fec                                                   0                                            
10508.BP138.3.fec                                                   3                                            
10508.BP13.6.fec                                                    2                                            
10508.BP14.6.fec                                                    0                                            
10508.BP15.6.fec                                                    0                                            
10508.BP16.6.fec                                                    0                                            
10508.BP17.6.fec                                                    0                                            
10508.BP18.6.fec                                                    0                                            
...                                                               ...                                            
10508.BP134.10.fec                                                  0                                            
10508.BP13.13.fec                                                   0                                            
10508.BP14.13.fec                                                   0                                            
10508.BP15.13.fec                                                   0                                            
10508.BP16.13.fec                                                   0                                            
10508.BP17.13.fec                                                   0                                            
10508.BP18.13.fec                                                   0                                            
10508.BP53.13.fec                                                4392                                            
10508.BP54.13.fec                                                3884                                            
10508.BP55.13.fec                                                3913                                            
10508.BP56.13.fec                                                3808                                            
10508.BP57.13.fec                                                3772                                            
10508.BP67.13.fec                                                 415                                            
10508.BP69.13.fec                                                 599                                            
10508.BP70.13.fec                                                 979                                            
10508.BP71.13.fec                                                 676                                            
10508.BP131.13.fec                                                  0                                            
10508.BP132.13.fec                                                  0                                            
10508.BP133.13.fec                                                  0                                            
10508.BP134.13.fec                                                  0                                            
10508.BP124.6.cec                                                   0                                            
10508.BP126.6.cec                                                   0                                            
10508.BP127.6.cec                                                   0                                            
10508.BP128.6.cec                                                   0                                            
10508.BP138.6.cec                                                   2                                            
10508.BP124.6.ile                                                   0                                            
10508.BP126.6.ile                                                   0                                            
10508.BP127.6.ile                                                   0                                            
10508.BP128.6.ile                                                   3                                            
10508.BP138.6.ile                                                   0                                            

                    TACAGAGGTCTCAAGCGTTGTTCGGAATCACTGGGCGTAAAGCGTGCGTAGGCTGTTTCGTAAGTCGTGTGTGAAAGGCGCGGGCTCAAC  \
#SampleID                                                                                                        
10508.BP13.3.fec                                                 8035                                            
10508.BP14.3.fec                                                 6708                                            
10508.BP15.3.fec                                                 6286                                            
10508.BP16.3.fec                                                 5453                                            
10508.BP17.3.fec                                                 5742                                            
10508.BP18.3.fec                                                10419                                            
10508.BP53.3.fec                                                 6425                                            
10508.BP54.3.fec                                                 5766                                            
10508.BP55.3.fec                                                 5539                                            
10508.BP56.3.fec                                                10083                                            
10508.BP57.3.fec                                                11334                                            
10508.BP67.3.fec                                                 4954                                            
10508.BP69.3.fec                                                 6650                                            
10508.BP70.3.fec                                                 3328                                            
10508.BP71.3.fec                                                 4119                                            
10508.BP124.3.fec                                                  72                                            
10508.BP126.3.fec                                                3153                                            
10508.BP127.3.fec                                                8465                                            
10508.BP128.3.fec                                                1462                                            
10508.BP131.3.fec                                                3000                                            
10508.BP132.3.fec                                               10163                                            
10508.BP133.3.fec                                                  70                                            
10508.BP134.3.fec                                                   0                                            
10508.BP138.3.fec                                                6307                                            
10508.BP13.6.fec                                                 7031                                            
10508.BP14.6.fec                                                 5520                                            
10508.BP15.6.fec                                                 3081                                            
10508.BP16.6.fec                                                 7819                                            
10508.BP17.6.fec                                                 5833                                            
10508.BP18.6.fec                                                 8927                                            
...                                                               ...                                            
10508.BP134.10.fec                                               1689                                            
10508.BP13.13.fec                                                1611                                            
10508.BP14.13.fec                                                1631                                            
10508.BP15.13.fec                                                1809                                            
10508.BP16.13.fec                                                1493                                            
10508.BP17.13.fec                                                1736                                            
10508.BP18.13.fec                                                1248                                            
10508.BP53.13.fec                                                 607                                            
10508.BP54.13.fec                                                1418                                            
10508.BP55.13.fec                                                 883                                            
10508.BP56.13.fec                                                 687                                            
10508.BP57.13.fec                                                1171                                            
10508.BP67.13.fec                                                3053                                            
10508.BP69.13.fec                                                3361                                            
10508.BP70.13.fec                                                2105                                            
10508.BP71.13.fec                                                1909                                            
10508.BP131.13.fec                                               2032                                            
10508.BP132.13.fec                                               1053                                            
10508.BP133.13.fec                                               1221                                            
10508.BP134.13.fec                                               2836                                            
10508.BP124.6.cec                                                5321                                            
10508.BP126.6.cec                                                6789                                            
10508.BP127.6.cec                                                7992                                            
10508.BP128.6.cec                                                7280                                            
10508.BP138.6.cec                                                5433                                            
10508.BP124.6.ile                                                4800                                            
10508.BP126.6.ile                                                8406                                            
10508.BP127.6.ile                                                6145                                            
10508.BP128.6.ile                                                6307                                            
10508.BP138.6.ile                                                6962                                            

                    TACGGAGGATGCGAGCGTTATCCGGATTTATTGGGTTTAAAGGGTGCGTAGGCGGCCTGCCAAGTCAGCGGTAAAATTGCGGGGCTCAAC  \
#SampleID                                                                                                        
10508.BP13.3.fec                                                    0                                            
10508.BP14.3.fec                                                    0                                            
10508.BP15.3.fec                                                    0                                            
10508.BP16.3.fec                                                    0                                            
10508.BP17.3.fec                                                    0                                            
10508.BP18.3.fec                                                    0                                            
10508.BP53.3.fec                                                    0                                            
10508.BP54.3.fec                                                    0                                            
10508.BP55.3.fec                                                    0                                            
10508.BP56.3.fec                                                    0                                            
10508.BP57.3.fec                                                    2                                            
10508.BP67.3.fec                                                    0                                            
10508.BP69.3.fec                                                    0                                            
10508.BP70.3.fec                                                    0                                            
10508.BP71.3.fec                                                    0                                            
10508.BP124.3.fec                                                   0                                            
10508.BP126.3.fec                                                   0                                            
10508.BP127.3.fec                                                   0                                            
10508.BP128.3.fec                                                   0                                            
10508.BP131.3.fec                                                   0                                            
10508.BP132.3.fec                                                   0                                            
10508.BP133.3.fec                                                   0                                            
10508.BP134.3.fec                                                   0                                            
10508.BP138.3.fec                                                   0                                            
10508.BP13.6.fec                                                    0                                            
10508.BP14.6.fec                                                    0                                            
10508.BP15.6.fec                                                    0                                            
10508.BP16.6.fec                                                    0                                            
10508.BP17.6.fec                                                    0                                            
10508.BP18.6.fec                                                    0                                            
...                                                               ...                                            
10508.BP134.10.fec                                                  0                                            
10508.BP13.13.fec                                                   0                                            
10508.BP14.13.fec                                                   0                                            
10508.BP15.13.fec                                                   0                                            
10508.BP16.13.fec                                                   0                                            
10508.BP17.13.fec                                                   0                                            
10508.BP18.13.fec                                                   0                                            
10508.BP53.13.fec                                                1108                                            
10508.BP54.13.fec                                                1067                                            
10508.BP55.13.fec                                                1229                                            
10508.BP56.13.fec                                                 898                                            
10508.BP57.13.fec                                                 818                                            
10508.BP67.13.fec                                                   0                                            
10508.BP69.13.fec                                                   0                                            
10508.BP70.13.fec                                                   0                                            
10508.BP71.13.fec                                                   0                                            
10508.BP131.13.fec                                                  0                                            
10508.BP132.13.fec                                                  0                                            
10508.BP133.13.fec                                                  0                                            
10508.BP134.13.fec                                                  0                                            
10508.BP124.6.cec                                                   0                                            
10508.BP126.6.cec                                                   0                                            
10508.BP127.6.cec                                                   0                                            
10508.BP128.6.cec                                                   0                                            
10508.BP138.6.cec                                                   0                                            
10508.BP124.6.ile                                                   0                                            
10508.BP126.6.ile                                                   0                                            
10508.BP127.6.ile                                                   0                                            
10508.BP128.6.ile                                                   0                                            
10508.BP138.6.ile                                                   0                                            

                    TACGGAGGATGCGAGCGTTATCCGGATTTATTGGGTTTAAAGGGTGCGTAGGCGGATTTGTAAGTCAGCGGTAAAAATGCGGTGCTCAAC  \
#SampleID                                                                                                        
10508.BP13.3.fec                                                    0                                            
10508.BP14.3.fec                                                    0                                            
10508.BP15.3.fec                                                    0                                            
10508.BP16.3.fec                                                    4                                            
10508.BP17.3.fec                                                    0                                            
10508.BP18.3.fec                                                    0                                            
10508.BP53.3.fec                                                    0                                            
10508.BP54.3.fec                                                    2                                            
10508.BP55.3.fec                                                    0                                            
10508.BP56.3.fec                                                    0                                            
10508.BP57.3.fec                                                    0                                            
10508.BP67.3.fec                                                    0                                            
10508.BP69.3.fec                                                    0                                            
10508.BP70.3.fec                                                    0                                            
10508.BP71.3.fec                                                    0                                            
10508.BP124.3.fec                                                   0                                            
10508.BP126.3.fec                                                   0                                            
10508.BP127.3.fec                                                   0                                            
10508.BP128.3.fec                                                   0                                            
10508.BP131.3.fec                                                   0                                            
10508.BP132.3.fec                                                   0                                            
10508.BP133.3.fec                                                   0                                            
10508.BP134.3.fec                                                   0                                            
10508.BP138.3.fec                                                   0                                            
10508.BP13.6.fec                                                    0                                            
10508.BP14.6.fec                                                    0                                            
10508.BP15.6.fec                                                    0                                            
10508.BP16.6.fec                                                    0                                            
10508.BP17.6.fec                                                    0                                            
10508.BP18.6.fec                                                    0                                            
...                                                               ...                                            
10508.BP134.10.fec                                                844                                            
10508.BP13.13.fec                                                   0                                            
10508.BP14.13.fec                                                   0                                            
10508.BP15.13.fec                                                   0                                            
10508.BP16.13.fec                                                   0                                            
10508.BP17.13.fec                                                   0                                            
10508.BP18.13.fec                                                   0                                            
10508.BP53.13.fec                                                   0                                            
10508.BP54.13.fec                                                   0                                            
10508.BP55.13.fec                                                   0                                            
10508.BP56.13.fec                                                   0                                            
10508.BP57.13.fec                                                   0                                            
10508.BP67.13.fec                                                 657                                            
10508.BP69.13.fec                                                 692                                            
10508.BP70.13.fec                                                 685                                            
10508.BP71.13.fec                                                 856                                            
10508.BP131.13.fec                                                198                                            
10508.BP132.13.fec                                                102                                            
10508.BP133.13.fec                                                121                                            
10508.BP134.13.fec                                                184                                            
10508.BP124.6.cec                                                   0                                            
10508.BP126.6.cec                                                   2                                            
10508.BP127.6.cec                                                   0                                            
10508.BP128.6.cec                                                   0                                            
10508.BP138.6.cec                                                   0                                            
10508.BP124.6.ile                                                   0                                            
10508.BP126.6.ile                                                   0                                            
10508.BP127.6.ile                                                   0                                            
10508.BP128.6.ile                                                   0                                            
10508.BP138.6.ile                                                   0                                            

                    TACGTAGGGGGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGTAGACGGAAGAGCAAGTCTGATGTGAAAGGCTGGGGCTTAAC  \
#SampleID                                                                                                        
10508.BP13.3.fec                                                    0                                            
10508.BP14.3.fec                                                    0                                            
10508.BP15.3.fec                                                    6                                            
10508.BP16.3.fec                                                    0                                            
10508.BP17.3.fec                                                    0                                            
10508.BP18.3.fec                                                    4                                            
10508.BP53.3.fec                                                 3454                                            
10508.BP54.3.fec                                                 3211                                            
10508.BP55.3.fec                                                 4300                                            
10508.BP56.3.fec                                                 6676                                            
10508.BP57.3.fec                                                 3898                                            
10508.BP67.3.fec                                                    2                                            
10508.BP69.3.fec                                                  378                                            
10508.BP70.3.fec                                                    0                                            
10508.BP71.3.fec                                                    7                                            
10508.BP124.3.fec                                                3702                                            
10508.BP126.3.fec                                                2192                                            
10508.BP127.3.fec                                                3986                                            
10508.BP128.3.fec                                                4910                                            
10508.BP131.3.fec                                                6205                                            
10508.BP132.3.fec                                                3969                                            
10508.BP133.3.fec                                                6035                                            
10508.BP134.3.fec                                                2974                                            
10508.BP138.3.fec                                                4930                                            
10508.BP13.6.fec                                                 3599                                            
10508.BP14.6.fec                                                 4180                                            
10508.BP15.6.fec                                                 2288                                            
10508.BP16.6.fec                                                 5691                                            
10508.BP17.6.fec                                                 3740                                            
10508.BP18.6.fec                                                 2620                                            
...                                                               ...                                            
10508.BP134.10.fec                                                870                                            
10508.BP13.13.fec                                                 934                                            
10508.BP14.13.fec                                                 900                                            
10508.BP15.13.fec                                                 817                                            
10508.BP16.13.fec                                                1153                                            
10508.BP17.13.fec                                                1526                                            
10508.BP18.13.fec                                                 762                                            
10508.BP53.13.fec                                                 399                                            
10508.BP54.13.fec                                                 548                                            
10508.BP55.13.fec                                                 570                                            
10508.BP56.13.fec                                                 411                                            
10508.BP57.13.fec                                                 457                                            
10508.BP67.13.fec                                                 689                                            
10508.BP69.13.fec                                                 662                                            
10508.BP70.13.fec                                                 567                                            
10508.BP71.13.fec                                                 576                                            
10508.BP131.13.fec                                                147                                            
10508.BP132.13.fec                                                 84                                            
10508.BP133.13.fec                                                 76                                            
10508.BP134.13.fec                                                230                                            
10508.BP124.6.cec                                                2692                                            
10508.BP126.6.cec                                                4368                                            
10508.BP127.6.cec                                                2939                                            
10508.BP128.6.cec                                                2780                                            
10508.BP138.6.cec                                                3113                                            
10508.BP124.6.ile                                                 829                                            
10508.BP126.6.ile                                                1652                                            
10508.BP127.6.ile                                                1095                                            
10508.BP128.6.ile                                                2014                                            
10508.BP138.6.ile                                                1271                                            

                    TACGTAGGGGGCAAGCGTTATCCGGAATTACTGGGTGTAAAGGGTGCGTAGGTGGCATGGTAAGTCAGAAGTGAAAGCCCGGGGCTTAAC  \
#SampleID                                                                                                        
10508.BP13.3.fec                                                    0                                            
10508.BP14.3.fec                                                    0                                            
10508.BP15.3.fec                                                    4                                            
10508.BP16.3.fec                                                    0                                            
10508.BP17.3.fec                                                    0                                            
10508.BP18.3.fec                                                    0                                            
10508.BP53.3.fec                                                    0                                            
10508.BP54.3.fec                                                    0                                            
10508.BP55.3.fec                                                    0                                            
10508.BP56.3.fec                                                    0                                            
10508.BP57.3.fec                                                    0                                            
10508.BP67.3.fec                                                    0                                            
10508.BP69.3.fec                                                    0                                            
10508.BP70.3.fec                                                    0                                            
10508.BP71.3.fec                                                    0                                            
10508.BP124.3.fec                                                   0                                            
10508.BP126.3.fec                                                   0                                            
10508.BP127.3.fec                                                   0                                            
10508.BP128.3.fec                                                   0                                            
10508.BP131.3.fec                                                   0                                            
10508.BP132.3.fec                                                   0                                            
10508.BP133.3.fec                                                   2                                            
10508.BP134.3.fec                                                   0                                            
10508.BP138.3.fec                                                   0                                            
10508.BP13.6.fec                                                  936                                            
10508.BP14.6.fec                                                 1250                                            
10508.BP15.6.fec                                                  574                                            
10508.BP16.6.fec                                                 1662                                            
10508.BP17.6.fec                                                 1101                                            
10508.BP18.6.fec                                                 1152                                            
...                                                               ...                                            
10508.BP134.10.fec                                                295                                            
10508.BP13.13.fec                                                  59                                            
10508.BP14.13.fec                                                  65                                            
10508.BP15.13.fec                                                  81                                            
10508.BP16.13.fec                                                 290                                            
10508.BP17.13.fec                                                 213                                            
10508.BP18.13.fec                                                 282                                            
10508.BP53.13.fec                                                  96                                            
10508.BP54.13.fec                                                  72                                            
10508.BP55.13.fec                                                  80                                            
10508.BP56.13.fec                                                 125                                            
10508.BP57.13.fec                                                 126                                            
10508.BP67.13.fec                                                  66                                            
10508.BP69.13.fec                                                  44                                            
10508.BP70.13.fec                                                  49                                            
10508.BP71.13.fec                                                  49                                            
10508.BP131.13.fec                                                 70                                            
10508.BP132.13.fec                                                 29                                            
10508.BP133.13.fec                                                 52                                            
10508.BP134.13.fec                                                 62                                            
10508.BP124.6.cec                                                1082                                            
10508.BP126.6.cec                                                1715                                            
10508.BP127.6.cec                                                1308                                            
10508.BP128.6.cec                                                1254                                            
10508.BP138.6.cec                                                2122                                            
10508.BP124.6.ile                                                 194                                            
10508.BP126.6.ile                                                1343                                            
10508.BP127.6.ile                                                 347                                            
10508.BP128.6.ile                                                 326                                            
10508.BP138.6.ile                                                 471                                            

                    TACGGAGGATGCGAGCGTTATCCGGATTTATTGGGTTTAAAGGGTGCGTAGGCGGATTTTTAAGTCAGCGGTAAAATGTCCGGGCTCAAC  \
#SampleID                                                                                                        
10508.BP13.3.fec                                                    2                                            
10508.BP14.3.fec                                                    0                                            
10508.BP15.3.fec                                                    0                                            
10508.BP16.3.fec                                                    0                                            
10508.BP17.3.fec                                                    2                                            
10508.BP18.3.fec                                                    0                                            
10508.BP53.3.fec                                                    0                                            
10508.BP54.3.fec                                                    0                                            
10508.BP55.3.fec                                                    0                                            
10508.BP56.3.fec                                                    5                                            
10508.BP57.3.fec                                                    0                                            
10508.BP67.3.fec                                                    0                                            
10508.BP69.3.fec                                                    4                                            
10508.BP70.3.fec                                                    0                                            
10508.BP71.3.fec                                                    0                                            
10508.BP124.3.fec                                                   0                                            
10508.BP126.3.fec                                                   0                                            
10508.BP127.3.fec                                                   2                                            
10508.BP128.3.fec                                                   2                                            
10508.BP131.3.fec                                                   2                                            
10508.BP132.3.fec                                                   2                                            
10508.BP133.3.fec                                                   0                                            
10508.BP134.3.fec                                                   2                                            
10508.BP138.3.fec                                                   0                                            
10508.BP13.6.fec                                                    0                                            
10508.BP14.6.fec                                                    5                                            
10508.BP15.6.fec                                                    0                                            
10508.BP16.6.fec                                                    3                                            
10508.BP17.6.fec                                                    0                                            
10508.BP18.6.fec                                                    0                                            
...                                                               ...                                            
10508.BP134.10.fec                                                287                                            
10508.BP13.13.fec                                                 722                                            
10508.BP14.13.fec                                                 598                                            
10508.BP15.13.fec                                                 525                                            
10508.BP16.13.fec                                                1775                                            
10508.BP17.13.fec                                                1095                                            
10508.BP18.13.fec                                                1278                                            
10508.BP53.13.fec                                                 198                                            
10508.BP54.13.fec                                                 157                                            
10508.BP55.13.fec                                                 212                                            
10508.BP56.13.fec                                                 271                                            
10508.BP57.13.fec                                                 236                                            
10508.BP67.13.fec                                                 245                                            
10508.BP69.13.fec                                                 234                                            
10508.BP70.13.fec                                                 260                                            
10508.BP71.13.fec                                                 202                                            
10508.BP131.13.fec                                                236                                            
10508.BP132.13.fec                                                178                                            
10508.BP133.13.fec                                                158                                            
10508.BP134.13.fec                                                375                                            
10508.BP124.6.cec                                                   0                                            
10508.BP126.6.cec                                                   0                                            
10508.BP127.6.cec                                                   3                                            
10508.BP128.6.cec                                                   2                                            
10508.BP138.6.cec                                                   0                                            
10508.BP124.6.ile                                                   0                                            
10508.BP126.6.ile                                                   2                                            
10508.BP127.6.ile                                                   0                                            
10508.BP128.6.ile                                                   0                                            
10508.BP138.6.ile                                                   0                                            

                    TACGGAGGATGCGAGCGTTATCCGGATTTATTGGGTTTAAAGGGTGCGTAGGCGGGGAGCCAAGTCAGCGGTAAAATCGTGGGGCTCAAC  \
#SampleID                                                                                                        
10508.BP13.3.fec                                                    0                                            
10508.BP14.3.fec                                                    0                                            
10508.BP15.3.fec                                                    0                                            
10508.BP16.3.fec                                                    0                                            
10508.BP17.3.fec                                                    0                                            
10508.BP18.3.fec                                                    0                                            
10508.BP53.3.fec                                                    0                                            
10508.BP54.3.fec                                                    0                                            
10508.BP55.3.fec                                                    0                                            
10508.BP56.3.fec                                                    0                                            
10508.BP57.3.fec                                                    0                                            
10508.BP67.3.fec                                                    0                                            
10508.BP69.3.fec                                                    0                                            
10508.BP70.3.fec                                                    0                                            
10508.BP71.3.fec                                                    0                                            
10508.BP124.3.fec                                                   0                                            
10508.BP126.3.fec                                                   0                                            
10508.BP127.3.fec                                                   0                                            
10508.BP128.3.fec                                                   0                                            
10508.BP131.3.fec                                                   0                                            
10508.BP132.3.fec                                                   0                                            
10508.BP133.3.fec                                                   0                                            
10508.BP134.3.fec                                                   0                                            
10508.BP138.3.fec                                                   0                                            
10508.BP13.6.fec                                                    0                                            
10508.BP14.6.fec                                                    0                                            
10508.BP15.6.fec                                                    0                                            
10508.BP16.6.fec                                                    0                                            
10508.BP17.6.fec                                                    0                                            
10508.BP18.6.fec                                                    0                                            
...                                                               ...                                            
10508.BP134.10.fec                                                  0                                            
10508.BP13.13.fec                                                   0                                            
10508.BP14.13.fec                                                   0                                            
10508.BP15.13.fec                                                   0                                            
10508.BP16.13.fec                                                   0                                            
10508.BP17.13.fec                                                   0                                            
10508.BP18.13.fec                                                   0                                            
10508.BP53.13.fec                                                 430                                            
10508.BP54.13.fec                                                 279                                            
10508.BP55.13.fec                                                 366                                            
10508.BP56.13.fec                                                 326                                            
10508.BP57.13.fec                                                 471                                            
10508.BP67.13.fec                                                   0                                            
10508.BP69.13.fec                                                   0                                            
10508.BP70.13.fec                                                   0                                            
10508.BP71.13.fec                                                   0                                            
10508.BP131.13.fec                                                  0                                            
10508.BP132.13.fec                                                  0                                            
10508.BP133.13.fec                                                  0                                            
10508.BP134.13.fec                                                  0                                            
10508.BP124.6.cec                                                   0                                            
10508.BP126.6.cec                                                   0                                            
10508.BP127.6.cec                                                   0                                            
10508.BP128.6.cec                                                   0                                            
10508.BP138.6.cec                                                   0                                            
10508.BP124.6.ile                                                   0                                            
10508.BP126.6.ile                                                   0                                            
10508.BP127.6.ile                                                   0                                            
10508.BP128.6.ile                                                   0                                            
10508.BP138.6.ile                                                   0                                            

                    TACGGAGGATGCGAGCGTTATCCGGATTTATTGGGTTTAAAGGGTGCGCAGGCGGAAGATCAAGTCAGCGGTAAAATTGAGAGGCTCAAC  \
#SampleID                                                                                                        
10508.BP13.3.fec                                                    0                                            
10508.BP14.3.fec                                                    0                                            
10508.BP15.3.fec                                                    0                                            
10508.BP16.3.fec                                                    0                                            
10508.BP17.3.fec                                                    0                                            
10508.BP18.3.fec                                                    0                                            
10508.BP53.3.fec                                                    0                                            
10508.BP54.3.fec                                                    0                                            
10508.BP55.3.fec                                                    0                                            
10508.BP56.3.fec                                                    0                                            
10508.BP57.3.fec                                                    0                                            
10508.BP67.3.fec                                                    0                                            
10508.BP69.3.fec                                                    0                                            
10508.BP70.3.fec                                                    0                                            
10508.BP71.3.fec                                                    0                                            
10508.BP124.3.fec                                                   0                                            
10508.BP126.3.fec                                                   0                                            
10508.BP127.3.fec                                                   0                                            
10508.BP128.3.fec                                                   0                                            
10508.BP131.3.fec                                                   0                                            
10508.BP132.3.fec                                                   0                                            
10508.BP133.3.fec                                                   0                                            
10508.BP134.3.fec                                                   0                                            
10508.BP138.3.fec                                                   0                                            
10508.BP13.6.fec                                                    0                                            
10508.BP14.6.fec                                                    0                                            
10508.BP15.6.fec                                                    0                                            
10508.BP16.6.fec                                                    0                                            
10508.BP17.6.fec                                                    0                                            
10508.BP18.6.fec                                                    0                                            
...                                                               ...                                            
10508.BP134.10.fec                                                  0                                            
10508.BP13.13.fec                                                   0                                            
10508.BP14.13.fec                                                   0                                            
10508.BP15.13.fec                                                   0                                            
10508.BP16.13.fec                                                   0                                            
10508.BP17.13.fec                                                   0                                            
10508.BP18.13.fec                                                   0                                            
10508.BP53.13.fec                                                 392                                            
10508.BP54.13.fec                                                 272                                            
10508.BP55.13.fec                                                 254                                            
10508.BP56.13.fec                                                 306                                            
10508.BP57.13.fec                                                 380                                            
10508.BP67.13.fec                                                   0                                            
10508.BP69.13.fec                                                   0                                            
10508.BP70.13.fec                                                   0                                            
10508.BP71.13.fec                                                   0                                            
10508.BP131.13.fec                                                  0                                            
10508.BP132.13.fec                                                  0                                            
10508.BP133.13.fec                                                  0                                            
10508.BP134.13.fec                                                  0                                            
10508.BP124.6.cec                                                   0                                            
10508.BP126.6.cec                                                   0                                            
10508.BP127.6.cec                                                   0                                            
10508.BP128.6.cec                                                   0                                            
10508.BP138.6.cec                                                   0                                            
10508.BP124.6.ile                                                   0                                            
10508.BP126.6.ile                                                   0                                            
10508.BP127.6.ile                                                   0                                            
10508.BP128.6.ile                                                   0                                            
10508.BP138.6.ile                                                   0                                            

                    TACGGAGGATGCGAGCGTTATCCGGATTTATTGGGTTTAAAGGGTGCGTAGGCGGAATATCAAGTCAGCGGTAAAAATTCGGGGCTCAAC  \
#SampleID                                                                                                        
10508.BP13.3.fec                                                    0                                            
10508.BP14.3.fec                                                    0                                            
10508.BP15.3.fec                                                    0                                            
10508.BP16.3.fec                                                    0                                            
10508.BP17.3.fec                                                    0                                            
10508.BP18.3.fec                                                    0                                            
10508.BP53.3.fec                                                    0                                            
10508.BP54.3.fec                                                    0                                            
10508.BP55.3.fec                                                    0                                            
10508.BP56.3.fec                                                    0                                            
10508.BP57.3.fec                                                    0                                            
10508.BP67.3.fec                                                    0                                            
10508.BP69.3.fec                                                    0                                            
10508.BP70.3.fec                                                    0                                            
10508.BP71.3.fec                                                    0                                            
10508.BP124.3.fec                                                   0                                            
10508.BP126.3.fec                                                   0                                            
10508.BP127.3.fec                                                   0                                            
10508.BP128.3.fec                                                   0                                            
10508.BP131.3.fec                                                   0                                            
10508.BP132.3.fec                                                   0                                            
10508.BP133.3.fec                                                   0                                            
10508.BP134.3.fec                                                   0                                            
10508.BP138.3.fec                                                   0                                            
10508.BP13.6.fec                                                    0                                            
10508.BP14.6.fec                                                    0                                            
10508.BP15.6.fec                                                    0                                            
10508.BP16.6.fec                                                    2                                            
10508.BP17.6.fec                                                    0                                            
10508.BP18.6.fec                                                    0                                            
...                                                               ...                                            
10508.BP134.10.fec                                                343                                            
10508.BP13.13.fec                                                 801                                            
10508.BP14.13.fec                                                 646                                            
10508.BP15.13.fec                                                 603                                            
10508.BP16.13.fec                                                 651                                            
10508.BP17.13.fec                                                 661                                            
10508.BP18.13.fec                                                 686                                            
10508.BP53.13.fec                                                 266                                            
10508.BP54.13.fec                                                 137                                            
10508.BP55.13.fec                                                 264                                            
10508.BP56.13.fec                                                 332                                            
10508.BP57.13.fec                                                 235                                            
10508.BP67.13.fec                                                 130                                            
10508.BP69.13.fec                                                 208                                            
10508.BP70.13.fec                                                 106                                            
10508.BP71.13.fec                                                  49                                            
10508.BP131.13.fec                                                107                                            
10508.BP132.13.fec                                                  0                                            
10508.BP133.13.fec                                                  0                                            
10508.BP134.13.fec                                                  0                                            
10508.BP124.6.cec                                                   0                                            
10508.BP126.6.cec                                                   0                                            
10508.BP127.6.cec                                                   0                                            
10508.BP128.6.cec                                                   0                                            
10508.BP138.6.cec                                                   0                                            
10508.BP124.6.ile                                                   0                                            
10508.BP126.6.ile                                                   0                                            
10508.BP127.6.ile                                                   0                                            
10508.BP128.6.ile                                                   0                                            
10508.BP138.6.ile                                                   0                                            

                                                               ...                                              \
#SampleID                                                      ...                                               
10508.BP13.3.fec                                               ...                                               
10508.BP14.3.fec                                               ...                                               
10508.BP15.3.fec                                               ...                                               
10508.BP16.3.fec                                               ...                                               
10508.BP17.3.fec                                               ...                                               
10508.BP18.3.fec                                               ...                                               
10508.BP53.3.fec                                               ...                                               
10508.BP54.3.fec                                               ...                                               
10508.BP55.3.fec                                               ...                                               
10508.BP56.3.fec                                               ...                                               
10508.BP57.3.fec                                               ...                                               
10508.BP67.3.fec                                               ...                                               
10508.BP69.3.fec                                               ...                                               
10508.BP70.3.fec                                               ...                                               
10508.BP71.3.fec                                               ...                                               
10508.BP124.3.fec                                              ...                                               
10508.BP126.3.fec                                              ...                                               
10508.BP127.3.fec                                              ...                                               
10508.BP128.3.fec                                              ...                                               
10508.BP131.3.fec                                              ...                                               
10508.BP132.3.fec                                              ...                                               
10508.BP133.3.fec                                              ...                                               
10508.BP134.3.fec                                              ...                                               
10508.BP138.3.fec                                              ...                                               
10508.BP13.6.fec                                               ...                                               
10508.BP14.6.fec                                               ...                                               
10508.BP15.6.fec                                               ...                                               
10508.BP16.6.fec                                               ...                                               
10508.BP17.6.fec                                               ...                                               
10508.BP18.6.fec                                               ...                                               
...                                                            ...                                               
10508.BP134.10.fec                                             ...                                               
10508.BP13.13.fec                                              ...                                               
10508.BP14.13.fec                                              ...                                               
10508.BP15.13.fec                                              ...                                               
10508.BP16.13.fec                                              ...                                               
10508.BP17.13.fec                                              ...                                               
10508.BP18.13.fec                                              ...                                               
10508.BP53.13.fec                                              ...                                               
10508.BP54.13.fec                                              ...                                               
10508.BP55.13.fec                                              ...                                               
10508.BP56.13.fec                                              ...                                               
10508.BP57.13.fec                                              ...                                               
10508.BP67.13.fec                                              ...                                               
10508.BP69.13.fec                                              ...                                               
10508.BP70.13.fec                                              ...                                               
10508.BP71.13.fec                                              ...                                               
10508.BP131.13.fec                                             ...                                               
10508.BP132.13.fec                                             ...                                               
10508.BP133.13.fec                                             ...                                               
10508.BP134.13.fec                                             ...                                               
10508.BP124.6.cec                                              ...                                               
10508.BP126.6.cec                                              ...                                               
10508.BP127.6.cec                                              ...                                               
10508.BP128.6.cec                                              ...                                               
10508.BP138.6.cec                                              ...                                               
10508.BP124.6.ile                                              ...                                               
10508.BP126.6.ile                                              ...                                               
10508.BP127.6.ile                                              ...                                               
10508.BP128.6.ile                                              ...                                               
10508.BP138.6.ile                                              ...                                               

                    TACGGAGGATGCGAGCGTTATCCGGATTTATTGGGTGTAAAGGGTGCGTAGACGGGAAAACAAGTTAGTTGTGAAATCCCTCGGCTTAAC  \
#SampleID                                                                                                        
10508.BP13.3.fec                                                    0                                            
10508.BP14.3.fec                                                    0                                            
10508.BP15.3.fec                                                    0                                            
10508.BP16.3.fec                                                    0                                            
10508.BP17.3.fec                                                    0                                            
10508.BP18.3.fec                                                    0                                            
10508.BP53.3.fec                                                    0                                            
10508.BP54.3.fec                                                    0                                            
10508.BP55.3.fec                                                    0                                            
10508.BP56.3.fec                                                    0                                            
10508.BP57.3.fec                                                    0                                            
10508.BP67.3.fec                                                    0                                            
10508.BP69.3.fec                                                    0                                            
10508.BP70.3.fec                                                    0                                            
10508.BP71.3.fec                                                    0                                            
10508.BP124.3.fec                                                   0                                            
10508.BP126.3.fec                                                   0                                            
10508.BP127.3.fec                                                   0                                            
10508.BP128.3.fec                                                   0                                            
10508.BP131.3.fec                                                   0                                            
10508.BP132.3.fec                                                   0                                            
10508.BP133.3.fec                                                   0                                            
10508.BP134.3.fec                                                   0                                            
10508.BP138.3.fec                                                   0                                            
10508.BP13.6.fec                                                    0                                            
10508.BP14.6.fec                                                    0                                            
10508.BP15.6.fec                                                    0                                            
10508.BP16.6.fec                                                    0                                            
10508.BP17.6.fec                                                    0                                            
10508.BP18.6.fec                                                    0                                            
...                                                               ...                                            
10508.BP134.10.fec                                                  0                                            
10508.BP13.13.fec                                                   0                                            
10508.BP14.13.fec                                                   0                                            
10508.BP15.13.fec                                                   0                                            
10508.BP16.13.fec                                                   0                                            
10508.BP17.13.fec                                                   0                                            
10508.BP18.13.fec                                                   0                                            
10508.BP53.13.fec                                                   0                                            
10508.BP54.13.fec                                                   0                                            
10508.BP55.13.fec                                                   0                                            
10508.BP56.13.fec                                                   0                                            
10508.BP57.13.fec                                                   0                                            
10508.BP67.13.fec                                                   0                                            
10508.BP69.13.fec                                                   0                                            
10508.BP70.13.fec                                                   0                                            
10508.BP71.13.fec                                                   0                                            
10508.BP131.13.fec                                                  0                                            
10508.BP132.13.fec                                                  0                                            
10508.BP133.13.fec                                                  0                                            
10508.BP134.13.fec                                                  0                                            
10508.BP124.6.cec                                                   0                                            
10508.BP126.6.cec                                                   0                                            
10508.BP127.6.cec                                                   0                                            
10508.BP128.6.cec                                                   0                                            
10508.BP138.6.cec                                                   0                                            
10508.BP124.6.ile                                                   0                                            
10508.BP126.6.ile                                                   0                                            
10508.BP127.6.ile                                                   0                                            
10508.BP128.6.ile                                                   0                                            
10508.BP138.6.ile                                                   0                                            

                    TACAGAGGGTGCAAGCGTTAATCGGAATTACTGGGCGTAAAGCGCGCGTAGGTGGTTTGTTAAGTTGGATGTGAAAGCCCCGGGCTCAAC  \
#SampleID                                                                                                        
10508.BP13.3.fec                                                    0                                            
10508.BP14.3.fec                                                    0                                            
10508.BP15.3.fec                                                    0                                            
10508.BP16.3.fec                                                    0                                            
10508.BP17.3.fec                                                    0                                            
10508.BP18.3.fec                                                    0                                            
10508.BP53.3.fec                                                    0                                            
10508.BP54.3.fec                                                    0                                            
10508.BP55.3.fec                                                    0                                            
10508.BP56.3.fec                                                    0                                            
10508.BP57.3.fec                                                    0                                            
10508.BP67.3.fec                                                    0                                            
10508.BP69.3.fec                                                    0                                            
10508.BP70.3.fec                                                    0                                            
10508.BP71.3.fec                                                    0                                            
10508.BP124.3.fec                                                   0                                            
10508.BP126.3.fec                                                   0                                            
10508.BP127.3.fec                                                   0                                            
10508.BP128.3.fec                                                   0                                            
10508.BP131.3.fec                                                   0                                            
10508.BP132.3.fec                                                   0                                            
10508.BP133.3.fec                                                   0                                            
10508.BP134.3.fec                                                   0                                            
10508.BP138.3.fec                                                   0                                            
10508.BP13.6.fec                                                    0                                            
10508.BP14.6.fec                                                    0                                            
10508.BP15.6.fec                                                    0                                            
10508.BP16.6.fec                                                    0                                            
10508.BP17.6.fec                                                    0                                            
10508.BP18.6.fec                                                    0                                            
...                                                               ...                                            
10508.BP134.10.fec                                                  0                                            
10508.BP13.13.fec                                                   0                                            
10508.BP14.13.fec                                                   0                                            
10508.BP15.13.fec                                                   0                                            
10508.BP16.13.fec                                                   0                                            
10508.BP17.13.fec                                                   0                                            
10508.BP18.13.fec                                                   0                                            
10508.BP53.13.fec                                                   0                                            
10508.BP54.13.fec                                                   0                                            
10508.BP55.13.fec                                                   0                                            
10508.BP56.13.fec                                                   0                                            
10508.BP57.13.fec                                                   0                                            
10508.BP67.13.fec                                                   0                                            
10508.BP69.13.fec                                                   0                                            
10508.BP70.13.fec                                                   0                                            
10508.BP71.13.fec                                                   0                                            
10508.BP131.13.fec                                                  0                                            
10508.BP132.13.fec                                                  0                                            
10508.BP133.13.fec                                                  0                                            
10508.BP134.13.fec                                                  0                                            
10508.BP124.6.cec                                                   0                                            
10508.BP126.6.cec                                                   0                                            
10508.BP127.6.cec                                                   0                                            
10508.BP128.6.cec                                                   0                                            
10508.BP138.6.cec                                                   0                                            
10508.BP124.6.ile                                                   0                                            
10508.BP126.6.ile                                                   0                                            
10508.BP127.6.ile                                                   0                                            
10508.BP128.6.ile                                                   0                                            
10508.BP138.6.ile                                                   0                                            

                    TACGTAGGTGGCGAGCGTTATCCGGATTTATTGGGCGTAAAGCGTGCGCAGGCGGTTTGTTAAGTCTAAAATTAAATCCCGAAGCTTAAC  \
#SampleID                                                                                                        
10508.BP13.3.fec                                                    0                                            
10508.BP14.3.fec                                                    0                                            
10508.BP15.3.fec                                                    0                                            
10508.BP16.3.fec                                                    0                                            
10508.BP17.3.fec                                                    0                                            
10508.BP18.3.fec                                                    0                                            
10508.BP53.3.fec                                                    0                                            
10508.BP54.3.fec                                                    0                                            
10508.BP55.3.fec                                                    0                                            
10508.BP56.3.fec                                                    0                                            
10508.BP57.3.fec                                                    0                                            
10508.BP67.3.fec                                                    0                                            
10508.BP69.3.fec                                                    0                                            
10508.BP70.3.fec                                                    0                                            
10508.BP71.3.fec                                                    0                                            
10508.BP124.3.fec                                                   0                                            
10508.BP126.3.fec                                                   0                                            
10508.BP127.3.fec                                                   0                                            
10508.BP128.3.fec                                                   0                                            
10508.BP131.3.fec                                                   0                                            
10508.BP132.3.fec                                                   0                                            
10508.BP133.3.fec                                                   0                                            
10508.BP134.3.fec                                                   0                                            
10508.BP138.3.fec                                                   0                                            
10508.BP13.6.fec                                                    0                                            
10508.BP14.6.fec                                                    0                                            
10508.BP15.6.fec                                                    0                                            
10508.BP16.6.fec                                                    0                                            
10508.BP17.6.fec                                                    0                                            
10508.BP18.6.fec                                                    0                                            
...                                                               ...                                            
10508.BP134.10.fec                                                  0                                            
10508.BP13.13.fec                                                   0                                            
10508.BP14.13.fec                                                   0                                            
10508.BP15.13.fec                                                   0                                            
10508.BP16.13.fec                                                   0                                            
10508.BP17.13.fec                                                   0                                            
10508.BP18.13.fec                                                   0                                            
10508.BP53.13.fec                                                   0                                            
10508.BP54.13.fec                                                   0                                            
10508.BP55.13.fec                                                   0                                            
10508.BP56.13.fec                                                   0                                            
10508.BP57.13.fec                                                   0                                            
10508.BP67.13.fec                                                   0                                            
10508.BP69.13.fec                                                   0                                            
10508.BP70.13.fec                                                   0                                            
10508.BP71.13.fec                                                   0                                            
10508.BP131.13.fec                                                  0                                            
10508.BP132.13.fec                                                  0                                            
10508.BP133.13.fec                                                  0                                            
10508.BP134.13.fec                                                  0                                            
10508.BP124.6.cec                                                   0                                            
10508.BP126.6.cec                                                   0                                            
10508.BP127.6.cec                                                   0                                            
10508.BP128.6.cec                                                   0                                            
10508.BP138.6.cec                                                   0                                            
10508.BP124.6.ile                                                   0                                            
10508.BP126.6.ile                                                   0                                            
10508.BP127.6.ile                                                   0                                            
10508.BP128.6.ile                                                   0                                            
10508.BP138.6.ile                                                   0                                            

                    TACGTATGGGGCGAGCGTTATCCGGATTCATTGGGCGTAAAGCGCGCGCAGGCGGGCTGCTAAGCGGGACCTCTAATCTCGGGGCTCAAC  \
#SampleID                                                                                                        
10508.BP13.3.fec                                                    0                                            
10508.BP14.3.fec                                                    0                                            
10508.BP15.3.fec                                                    0                                            
10508.BP16.3.fec                                                    0                                            
10508.BP17.3.fec                                                    0                                            
10508.BP18.3.fec                                                    0                                            
10508.BP53.3.fec                                                    0                                            
10508.BP54.3.fec                                                    0                                            
10508.BP55.3.fec                                                    0                                            
10508.BP56.3.fec                                                    0                                            
10508.BP57.3.fec                                                    0                                            
10508.BP67.3.fec                                                    0                                            
10508.BP69.3.fec                                                    0                                            
10508.BP70.3.fec                                                    0                                            
10508.BP71.3.fec                                                    0                                            
10508.BP124.3.fec                                                   0                                            
10508.BP126.3.fec                                                   0                                            
10508.BP127.3.fec                                                   0                                            
10508.BP128.3.fec                                                   0                                            
10508.BP131.3.fec                                                   0                                            
10508.BP132.3.fec                                                   0                                            
10508.BP133.3.fec                                                   0                                            
10508.BP134.3.fec                                                   0                                            
10508.BP138.3.fec                                                   0                                            
10508.BP13.6.fec                                                    0                                            
10508.BP14.6.fec                                                    0                                            
10508.BP15.6.fec                                                    0                                            
10508.BP16.6.fec                                                    0                                            
10508.BP17.6.fec                                                    0                                            
10508.BP18.6.fec                                                    0                                            
...                                                               ...                                            
10508.BP134.10.fec                                                  0                                            
10508.BP13.13.fec                                                   0                                            
10508.BP14.13.fec                                                   0                                            
10508.BP15.13.fec                                                   0                                            
10508.BP16.13.fec                                                   0                                            
10508.BP17.13.fec                                                   0                                            
10508.BP18.13.fec                                                   0                                            
10508.BP53.13.fec                                                   0                                            
10508.BP54.13.fec                                                   0                                            
10508.BP55.13.fec                                                   0                                            
10508.BP56.13.fec                                                   0                                            
10508.BP57.13.fec                                                   0                                            
10508.BP67.13.fec                                                   0                                            
10508.BP69.13.fec                                                   0                                            
10508.BP70.13.fec                                                   0                                            
10508.BP71.13.fec                                                   0                                            
10508.BP131.13.fec                                                  0                                            
10508.BP132.13.fec                                                  0                                            
10508.BP133.13.fec                                                  0                                            
10508.BP134.13.fec                                                  0                                            
10508.BP124.6.cec                                                   0                                            
10508.BP126.6.cec                                                   0                                            
10508.BP127.6.cec                                                   0                                            
10508.BP128.6.cec                                                   0                                            
10508.BP138.6.cec                                                   0                                            
10508.BP124.6.ile                                                   0                                            
10508.BP126.6.ile                                                   0                                            
10508.BP127.6.ile                                                   0                                            
10508.BP128.6.ile                                                   0                                            
10508.BP138.6.ile                                                   0                                            

                    TACGTAGGGAGCAAGCGTTATCCGGATTTATTGGGTGTAAAGGGTGCGTAGACGGGCTAACAAGTTAGTTGTGAAATCCCTCAGCTTAAC  \
#SampleID                                                                                                        
10508.BP13.3.fec                                                    0                                            
10508.BP14.3.fec                                                    0                                            
10508.BP15.3.fec                                                    0                                            
10508.BP16.3.fec                                                    0                                            
10508.BP17.3.fec                                                    0                                            
10508.BP18.3.fec                                                    0                                            
10508.BP53.3.fec                                                    0                                            
10508.BP54.3.fec                                                    0                                            
10508.BP55.3.fec                                                    0                                            
10508.BP56.3.fec                                                    0                                            
10508.BP57.3.fec                                                    0                                            
10508.BP67.3.fec                                                    0                                            
10508.BP69.3.fec                                                    0                                            
10508.BP70.3.fec                                                    0                                            
10508.BP71.3.fec                                                    0                                            
10508.BP124.3.fec                                                   0                                            
10508.BP126.3.fec                                                   0                                            
10508.BP127.3.fec                                                   0                                            
10508.BP128.3.fec                                                   0                                            
10508.BP131.3.fec                                                   0                                            
10508.BP132.3.fec                                                   0                                            
10508.BP133.3.fec                                                   0                                            
10508.BP134.3.fec                                                   0                                            
10508.BP138.3.fec                                                   0                                            
10508.BP13.6.fec                                                    0                                            
10508.BP14.6.fec                                                    0                                            
10508.BP15.6.fec                                                    0                                            
10508.BP16.6.fec                                                    0                                            
10508.BP17.6.fec                                                    0                                            
10508.BP18.6.fec                                                    0                                            
...                                                               ...                                            
10508.BP134.10.fec                                                  0                                            
10508.BP13.13.fec                                                   0                                            
10508.BP14.13.fec                                                   0                                            
10508.BP15.13.fec                                                   0                                            
10508.BP16.13.fec                                                   0                                            
10508.BP17.13.fec                                                   0                                            
10508.BP18.13.fec                                                   0                                            
10508.BP53.13.fec                                                   0                                            
10508.BP54.13.fec                                                   0                                            
10508.BP55.13.fec                                                   0                                            
10508.BP56.13.fec                                                   0                                            
10508.BP57.13.fec                                                   0                                            
10508.BP67.13.fec                                                   0                                            
10508.BP69.13.fec                                                   0                                            
10508.BP70.13.fec                                                   0                                            
10508.BP71.13.fec                                                   0                                            
10508.BP131.13.fec                                                  0                                            
10508.BP132.13.fec                                                  0                                            
10508.BP133.13.fec                                                  0                                            
10508.BP134.13.fec                                                  0                                            
10508.BP124.6.cec                                                   0                                            
10508.BP126.6.cec                                                   0                                            
10508.BP127.6.cec                                                   0                                            
10508.BP128.6.cec                                                   0                                            
10508.BP138.6.cec                                                   0                                            
10508.BP124.6.ile                                                   0                                            
10508.BP126.6.ile                                                   0                                            
10508.BP127.6.ile                                                   0                                            
10508.BP128.6.ile                                                   0                                            
10508.BP138.6.ile                                                   0                                            

                    TACGGAGGATGCGAGCGTTATCCGGATTTATTGGGTTTAAAGGGTGCGTAGGCGGACGGTCAAGTCAGCGGTAAAAATGCGGTGCTCAAC  \
#SampleID                                                                                                        
10508.BP13.3.fec                                                    0                                            
10508.BP14.3.fec                                                    0                                            
10508.BP15.3.fec                                                    0                                            
10508.BP16.3.fec                                                    0                                            
10508.BP17.3.fec                                                    0                                            
10508.BP18.3.fec                                                    0                                            
10508.BP53.3.fec                                                    0                                            
10508.BP54.3.fec                                                    0                                            
10508.BP55.3.fec                                                    0                                            
10508.BP56.3.fec                                                    0                                            
10508.BP57.3.fec                                                    0                                            
10508.BP67.3.fec                                                    0                                            
10508.BP69.3.fec                                                    0                                            
10508.BP70.3.fec                                                    0                                            
10508.BP71.3.fec                                                    0                                            
10508.BP124.3.fec                                                   0                                            
10508.BP126.3.fec                                                   0                                            
10508.BP127.3.fec                                                   0                                            
10508.BP128.3.fec                                                   0                                            
10508.BP131.3.fec                                                   0                                            
10508.BP132.3.fec                                                   0                                            
10508.BP133.3.fec                                                   0                                            
10508.BP134.3.fec                                                   0                                            
10508.BP138.3.fec                                                   0                                            
10508.BP13.6.fec                                                    0                                            
10508.BP14.6.fec                                                    0                                            
10508.BP15.6.fec                                                    0                                            
10508.BP16.6.fec                                                    0                                            
10508.BP17.6.fec                                                    0                                            
10508.BP18.6.fec                                                    0                                            
...                                                               ...                                            
10508.BP134.10.fec                                                  0                                            
10508.BP13.13.fec                                                   0                                            
10508.BP14.13.fec                                                   0                                            
10508.BP15.13.fec                                                   0                                            
10508.BP16.13.fec                                                   0                                            
10508.BP17.13.fec                                                   0                                            
10508.BP18.13.fec                                                   0                                            
10508.BP53.13.fec                                                   0                                            
10508.BP54.13.fec                                                   0                                            
10508.BP55.13.fec                                                   0                                            
10508.BP56.13.fec                                                   0                                            
10508.BP57.13.fec                                                   0                                            
10508.BP67.13.fec                                                   0                                            
10508.BP69.13.fec                                                   0                                            
10508.BP70.13.fec                                                   0                                            
10508.BP71.13.fec                                                   0                                            
10508.BP131.13.fec                                                  0                                            
10508.BP132.13.fec                                                  0                                            
10508.BP133.13.fec                                                  0                                            
10508.BP134.13.fec                                                  0                                            
10508.BP124.6.cec                                                   0                                            
10508.BP126.6.cec                                                   0                                            
10508.BP127.6.cec                                                   0                                            
10508.BP128.6.cec                                                   0                                            
10508.BP138.6.cec                                                   0                                            
10508.BP124.6.ile                                                   0                                            
10508.BP126.6.ile                                                   0                                            
10508.BP127.6.ile                                                   0                                            
10508.BP128.6.ile                                                   0                                            
10508.BP138.6.ile                                                   0                                            

                    TACGTATGGAGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGTAGACGGCATGGCAAGTCTGATGTGAAAGCCCGGGGCTCAAC  \
#SampleID                                                                                                        
10508.BP13.3.fec                                                    0                                            
10508.BP14.3.fec                                                    0                                            
10508.BP15.3.fec                                                    0                                            
10508.BP16.3.fec                                                    0                                            
10508.BP17.3.fec                                                    0                                            
10508.BP18.3.fec                                                    0                                            
10508.BP53.3.fec                                                    0                                            
10508.BP54.3.fec                                                    0                                            
10508.BP55.3.fec                                                    0                                            
10508.BP56.3.fec                                                    0                                            
10508.BP57.3.fec                                                    0                                            
10508.BP67.3.fec                                                    0                                            
10508.BP69.3.fec                                                    0                                            
10508.BP70.3.fec                                                    0                                            
10508.BP71.3.fec                                                    0                                            
10508.BP124.3.fec                                                   0                                            
10508.BP126.3.fec                                                   0                                            
10508.BP127.3.fec                                                   0                                            
10508.BP128.3.fec                                                   0                                            
10508.BP131.3.fec                                                   0                                            
10508.BP132.3.fec                                                   0                                            
10508.BP133.3.fec                                                   0                                            
10508.BP134.3.fec                                                   0                                            
10508.BP138.3.fec                                                   0                                            
10508.BP13.6.fec                                                    0                                            
10508.BP14.6.fec                                                    0                                            
10508.BP15.6.fec                                                    0                                            
10508.BP16.6.fec                                                    0                                            
10508.BP17.6.fec                                                    0                                            
10508.BP18.6.fec                                                    0                                            
...                                                               ...                                            
10508.BP134.10.fec                                                  0                                            
10508.BP13.13.fec                                                   0                                            
10508.BP14.13.fec                                                   0                                            
10508.BP15.13.fec                                                   0                                            
10508.BP16.13.fec                                                   0                                            
10508.BP17.13.fec                                                   0                                            
10508.BP18.13.fec                                                   0                                            
10508.BP53.13.fec                                                   0                                            
10508.BP54.13.fec                                                   0                                            
10508.BP55.13.fec                                                   0                                            
10508.BP56.13.fec                                                   0                                            
10508.BP57.13.fec                                                   0                                            
10508.BP67.13.fec                                                   0                                            
10508.BP69.13.fec                                                   0                                            
10508.BP70.13.fec                                                   0                                            
10508.BP71.13.fec                                                   0                                            
10508.BP131.13.fec                                                  0                                            
10508.BP132.13.fec                                                  0                                            
10508.BP133.13.fec                                                  0                                            
10508.BP134.13.fec                                                  0                                            
10508.BP124.6.cec                                                   0                                            
10508.BP126.6.cec                                                   0                                            
10508.BP127.6.cec                                                   0                                            
10508.BP128.6.cec                                                   0                                            
10508.BP138.6.cec                                                   0                                            
10508.BP124.6.ile                                                   0                                            
10508.BP126.6.ile                                                   0                                            
10508.BP127.6.ile                                                   0                                            
10508.BP128.6.ile                                                   0                                            
10508.BP138.6.ile                                                   0                                            

                    TACGTAGGTGGCAAGCGTTATCCGGATTTATTGGGCGTAAAGCGAGCGCAGGCGGTTTCTTAAGTCTGATGTGAAAGCCCCCGGCTCAAC  \
#SampleID                                                                                                        
10508.BP13.3.fec                                                    0                                            
10508.BP14.3.fec                                                    0                                            
10508.BP15.3.fec                                                    0                                            
10508.BP16.3.fec                                                    0                                            
10508.BP17.3.fec                                                    0                                            
10508.BP18.3.fec                                                    0                                            
10508.BP53.3.fec                                                    0                                            
10508.BP54.3.fec                                                    0                                            
10508.BP55.3.fec                                                    0                                            
10508.BP56.3.fec                                                    0                                            
10508.BP57.3.fec                                                    0                                            
10508.BP67.3.fec                                                    0                                            
10508.BP69.3.fec                                                    0                                            
10508.BP70.3.fec                                                    0                                            
10508.BP71.3.fec                                                    0                                            
10508.BP124.3.fec                                                   0                                            
10508.BP126.3.fec                                                   0                                            
10508.BP127.3.fec                                                   0                                            
10508.BP128.3.fec                                                   0                                            
10508.BP131.3.fec                                                   0                                            
10508.BP132.3.fec                                                   0                                            
10508.BP133.3.fec                                                   0                                            
10508.BP134.3.fec                                                   0                                            
10508.BP138.3.fec                                                   0                                            
10508.BP13.6.fec                                                    0                                            
10508.BP14.6.fec                                                    0                                            
10508.BP15.6.fec                                                    0                                            
10508.BP16.6.fec                                                    0                                            
10508.BP17.6.fec                                                    0                                            
10508.BP18.6.fec                                                    0                                            
...                                                               ...                                            
10508.BP134.10.fec                                                  0                                            
10508.BP13.13.fec                                                   0                                            
10508.BP14.13.fec                                                   0                                            
10508.BP15.13.fec                                                   0                                            
10508.BP16.13.fec                                                   0                                            
10508.BP17.13.fec                                                   0                                            
10508.BP18.13.fec                                                   0                                            
10508.BP53.13.fec                                                   0                                            
10508.BP54.13.fec                                                   0                                            
10508.BP55.13.fec                                                   0                                            
10508.BP56.13.fec                                                   0                                            
10508.BP57.13.fec                                                   0                                            
10508.BP67.13.fec                                                   0                                            
10508.BP69.13.fec                                                   0                                            
10508.BP70.13.fec                                                   0                                            
10508.BP71.13.fec                                                   0                                            
10508.BP131.13.fec                                                  0                                            
10508.BP132.13.fec                                                  0                                            
10508.BP133.13.fec                                                  0                                            
10508.BP134.13.fec                                                  0                                            
10508.BP124.6.cec                                                   0                                            
10508.BP126.6.cec                                                   0                                            
10508.BP127.6.cec                                                   0                                            
10508.BP128.6.cec                                                   0                                            
10508.BP138.6.cec                                                   0                                            
10508.BP124.6.ile                                                   0                                            
10508.BP126.6.ile                                                   0                                            
10508.BP127.6.ile                                                   0                                            
10508.BP128.6.ile                                                   0                                            
10508.BP138.6.ile                                                   0                                            

                    TACGTAGGGAGCAAGCGTTATCCGGATTTATTGGGTGTAAAGGGTGCGTAGACGGGAAAACAAGTTGGTTGTGAAATCCCTCGGCTTAAC  \
#SampleID                                                                                                        
10508.BP13.3.fec                                                    0                                            
10508.BP14.3.fec                                                    0                                            
10508.BP15.3.fec                                                    0                                            
10508.BP16.3.fec                                                    0                                            
10508.BP17.3.fec                                                    0                                            
10508.BP18.3.fec                                                    0                                            
10508.BP53.3.fec                                                    0                                            
10508.BP54.3.fec                                                    0                                            
10508.BP55.3.fec                                                    0                                            
10508.BP56.3.fec                                                    0                                            
10508.BP57.3.fec                                                    0                                            
10508.BP67.3.fec                                                    0                                            
10508.BP69.3.fec                                                    0                                            
10508.BP70.3.fec                                                    0                                            
10508.BP71.3.fec                                                    0                                            
10508.BP124.3.fec                                                   0                                            
10508.BP126.3.fec                                                   0                                            
10508.BP127.3.fec                                                   0                                            
10508.BP128.3.fec                                                   0                                            
10508.BP131.3.fec                                                   0                                            
10508.BP132.3.fec                                                   0                                            
10508.BP133.3.fec                                                   0                                            
10508.BP134.3.fec                                                   0                                            
10508.BP138.3.fec                                                   0                                            
10508.BP13.6.fec                                                    0                                            
10508.BP14.6.fec                                                    0                                            
10508.BP15.6.fec                                                    0                                            
10508.BP16.6.fec                                                    0                                            
10508.BP17.6.fec                                                    0                                            
10508.BP18.6.fec                                                    0                                            
...                                                               ...                                            
10508.BP134.10.fec                                                  0                                            
10508.BP13.13.fec                                                   0                                            
10508.BP14.13.fec                                                   0                                            
10508.BP15.13.fec                                                   0                                            
10508.BP16.13.fec                                                   0                                            
10508.BP17.13.fec                                                   0                                            
10508.BP18.13.fec                                                   0                                            
10508.BP53.13.fec                                                   0                                            
10508.BP54.13.fec                                                   0                                            
10508.BP55.13.fec                                                   0                                            
10508.BP56.13.fec                                                   0                                            
10508.BP57.13.fec                                                   0                                            
10508.BP67.13.fec                                                   0                                            
10508.BP69.13.fec                                                   0                                            
10508.BP70.13.fec                                                   0                                            
10508.BP71.13.fec                                                   0                                            
10508.BP131.13.fec                                                  0                                            
10508.BP132.13.fec                                                  0                                            
10508.BP133.13.fec                                                  0                                            
10508.BP134.13.fec                                                  0                                            
10508.BP124.6.cec                                                   0                                            
10508.BP126.6.cec                                                   0                                            
10508.BP127.6.cec                                                   0                                            
10508.BP128.6.cec                                                   0                                            
10508.BP138.6.cec                                                   0                                            
10508.BP124.6.ile                                                   0                                            
10508.BP126.6.ile                                                   0                                            
10508.BP127.6.ile                                                   0                                            
10508.BP128.6.ile                                                   0                                            
10508.BP138.6.ile                                                   0                                            

                    TACGTAGGTGGCAAGCGTTGTCCGGATTTATTGGGCGTAAAGCGAGCGCAGGCGGTTTCTTAAGTCTGATGTGAAAGCCCACGGCTTAAC  
#SampleID                                                                                                       
10508.BP13.3.fec                                                    0                                           
10508.BP14.3.fec                                                    0                                           
10508.BP15.3.fec                                                    0                                           
10508.BP16.3.fec                                                    0                                           
10508.BP17.3.fec                                                    0                                           
10508.BP18.3.fec                                                    0                                           
10508.BP53.3.fec                                                    0                                           
10508.BP54.3.fec                                                    0                                           
10508.BP55.3.fec                                                    0                                           
10508.BP56.3.fec                                                    0                                           
10508.BP57.3.fec                                                    0                                           
10508.BP67.3.fec                                                    0                                           
10508.BP69.3.fec                                                    0                                           
10508.BP70.3.fec                                                    0                                           
10508.BP71.3.fec                                                    0                                           
10508.BP124.3.fec                                                   0                                           
10508.BP126.3.fec                                                   0                                           
10508.BP127.3.fec                                                   0                                           
10508.BP128.3.fec                                                   0                                           
10508.BP131.3.fec                                                   0                                           
10508.BP132.3.fec                                                   0                                           
10508.BP133.3.fec                                                   0                                           
10508.BP134.3.fec                                                   0                                           
10508.BP138.3.fec                                                   0                                           
10508.BP13.6.fec                                                    0                                           
10508.BP14.6.fec                                                    0                                           
10508.BP15.6.fec                                                    0                                           
10508.BP16.6.fec                                                    0                                           
10508.BP17.6.fec                                                    0                                           
10508.BP18.6.fec                                                    0                                           
...                                                               ...                                           
10508.BP134.10.fec                                                  0                                           
10508.BP13.13.fec                                                   0                                           
10508.BP14.13.fec                                                   0                                           
10508.BP15.13.fec                                                   0                                           
10508.BP16.13.fec                                                   0                                           
10508.BP17.13.fec                                                   0                                           
10508.BP18.13.fec                                                   0                                           
10508.BP53.13.fec                                                   0                                           
10508.BP54.13.fec                                                   0                                           
10508.BP55.13.fec                                                   0                                           
10508.BP56.13.fec                                                   0                                           
10508.BP57.13.fec                                                   0                                           
10508.BP67.13.fec                                                   0                                           
10508.BP69.13.fec                                                   0                                           
10508.BP70.13.fec                                                   0                                           
10508.BP71.13.fec                                                   0                                           
10508.BP131.13.fec                                                  0                                           
10508.BP132.13.fec                                                  0                                           
10508.BP133.13.fec                                                  0                                           
10508.BP134.13.fec                                                  0                                           
10508.BP124.6.cec                                                   0                                           
10508.BP126.6.cec                                                   0                                           
10508.BP127.6.cec                                                   0                                           
10508.BP128.6.cec                                                   0                                           
10508.BP138.6.cec                                                   0                                           
10508.BP124.6.ile                                                   0                                           
10508.BP126.6.ile                                                   0                                           
10508.BP127.6.ile                                                   0                                           
10508.BP128.6.ile                                                   0                                           
10508.BP138.6.ile                                                   0                                           

[96 rows x 505 columns]
</pre>
</div>
</div>

</div>
</div>

</div>
<div class="cell border-box-sizing code_cell rendered">
<div class="input">
<div class="prompt input_prompt">In&nbsp;[479]:</div>
<div class="inner_cell">
    <div class="input_area">
<div class=" highlight hl-ipython3"><pre><span></span><span class="c1">#Attempt at splitting data into test and training data </span>
<span class="kn">from</span> <span class="nn">sklearn.cross_validation</span> <span class="k">import</span> <span class="n">train_test_split</span>
<span class="n">X_train</span><span class="p">,</span> <span class="n">X_test</span><span class="p">,</span> <span class="n">y_train</span><span class="p">,</span> <span class="n">y_test</span> <span class="o">=</span> <span class="n">train_test_split</span><span class="p">(</span><span class="n">c</span><span class="o">.</span><span class="n">fillna</span><span class="p">(</span><span class="mi">0</span><span class="p">)</span><span class="o">.</span><span class="n">as_matrix</span><span class="p">(),</span> <span class="n">i_2</span><span class="o">.</span><span class="n">diabetes</span><span class="p">,</span> <span class="n">test_size</span><span class="o">=</span><span class="mf">0.10</span><span class="p">,</span> <span class="n">random_state</span><span class="o">=</span><span class="mi">10</span><span class="p">)</span>
</pre></div>

</div>
</div>
</div>

</div>
<div class="cell border-box-sizing code_cell rendered">
<div class="input">
<div class="prompt input_prompt">In&nbsp;[480]:</div>
<div class="inner_cell">
    <div class="input_area">
<div class=" highlight hl-ipython3"><pre><span></span><span class="kn">from</span> <span class="nn">sklearn.ensemble</span> <span class="k">import</span> <span class="n">RandomForestClassifier</span>
</pre></div>

</div>
</div>
</div>

</div>
<div class="cell border-box-sizing code_cell rendered">
<div class="input">
<div class="prompt input_prompt">In&nbsp;[481]:</div>
<div class="inner_cell">
    <div class="input_area">
<div class=" highlight hl-ipython3"><pre><span></span><span class="n">v</span> <span class="o">=</span> <span class="mi">1000</span><span class="p">;</span>
<span class="n">classifier</span> <span class="o">=</span> <span class="n">RandomForestClassifier</span><span class="p">(</span><span class="n">n_estimators</span> <span class="o">=</span> <span class="n">v</span><span class="p">)</span>
<span class="c1">#classifier = RandomForestClassifier(n_estimators = v, n_jobs=-1)</span>
<span class="c1"># 25 - 75 split</span>
<span class="n">classifier</span><span class="o">.</span><span class="n">fit</span><span class="p">(</span><span class="n">X_train</span><span class="p">,</span> <span class="n">y_train</span><span class="p">)</span>
<span class="n">classifier</span><span class="o">.</span><span class="n">score</span><span class="p">(</span><span class="n">X_test</span><span class="p">,</span> <span class="n">y_test</span><span class="p">)</span> <span class="o">*</span> <span class="mi">100</span>
</pre></div>

</div>
</div>
</div>

<div class="output_wrapper">
<div class="output">


<div class="output_area"><div class="prompt output_prompt">Out[481]:</div>


<div class="output_text output_subarea output_execute_result">
<pre>80.0</pre>
</div>

</div>

</div>
</div>

</div>
<div class="cell border-box-sizing code_cell rendered">
<div class="input">
<div class="prompt input_prompt">In&nbsp;[463]:</div>
<div class="inner_cell">
    <div class="input_area">
<div class=" highlight hl-ipython3"><pre><span></span><span class="c1"># 10 fold (cross-validation)</span>
<span class="kn">from</span> <span class="nn">sklearn</span> <span class="k">import</span> <span class="n">model_selection</span>
<span class="n">seed</span> <span class="o">=</span> <span class="mi">10</span>
<span class="n">num_trees</span> <span class="o">=</span> <span class="mi">2000</span>
<span class="c1">#max_features = </span>
<span class="n">kfold</span> <span class="o">=</span> <span class="n">model_selection</span><span class="o">.</span><span class="n">KFold</span><span class="p">(</span><span class="n">n_splits</span><span class="o">=</span><span class="mi">10</span><span class="p">,</span><span class="n">random_state</span><span class="o">=</span><span class="n">seed</span><span class="p">)</span>
<span class="n">model</span> <span class="o">=</span> <span class="n">RandomForestClassifier</span><span class="p">(</span><span class="n">n_estimators</span><span class="o">=</span><span class="n">num_trees</span><span class="p">)</span>
<span class="n">results</span> <span class="o">=</span> <span class="n">model_selection</span><span class="o">.</span><span class="n">cross_val_score</span><span class="p">(</span><span class="n">model</span><span class="p">,</span><span class="n">c</span><span class="o">.</span><span class="n">fillna</span><span class="p">(</span><span class="mi">0</span><span class="p">)</span><span class="o">.</span><span class="n">as_matrix</span><span class="p">(),</span> <span class="n">i_2</span><span class="o">.</span><span class="n">diabetes</span> <span class="p">,</span> <span class="n">cv</span><span class="o">=</span><span class="n">kfold</span><span class="p">)</span>
<span class="nb">print</span><span class="p">(</span><span class="n">results</span><span class="o">.</span><span class="n">mean</span><span class="p">())</span>
</pre></div>

</div>
</div>
</div>

<div class="output_wrapper">
<div class="output">


<div class="output_area"><div class="prompt"></div>
<div class="output_subarea output_stream output_stdout output_text">
<pre>0.456666666667
</pre>
</div>
</div>

</div>
</div>

</div>
<div class="cell border-box-sizing code_cell rendered">
<div class="input">
<div class="prompt input_prompt">In&nbsp;[&nbsp;]:</div>
<div class="inner_cell">
    <div class="input_area">
<div class=" highlight hl-ipython3"><pre><span></span> 
</pre></div>

</div>
</div>
</div>

</div>
    </div>
  </div>
</body>
</html>