canonical-data.json

{
  "exercise": "nucleotide-count",
  "comments": [
    "Given a string of nucleotides, the count of each nucleotide is returned.",
    "",
    "It is the track's responsibility to add further language specific tests like:",
    "input error handling (null/undefined parameters etc.)",
    "referential transparency (i.e. evaluating, a function/method gives the same value for same arguments every time.)",
    "",
    "'error' and 'null' should be treated according to the languages' specifics and possibilities."
  ],
  "version": "1.1.0",
  "cases": [
    {
      "description": "counts all nucleotides in a provided strand.",
      "comments": [
        "nucleotideCounts counts all DNA-nucleotides in the input strand and returns an object with properties",
        "A, C, G and T holding their respective amounts."
      ],
      "cases": [
        {
          "description": "returns zeroes in case of an empty input strand.",
          "property": "nucleotideCounts",
          "strand": "",
          "expected": {
            "A": 0,
            "C": 0,
            "G": 0,
            "T": 0
          }
        },
        {
          "description": "can count one nucleotide in single-character input.",
          "property": "nucleotideCounts",
          "strand": "G",
          "expected": {
            "A": 0,
            "C": 0,
            "G": 1,
            "T": 0
          }
        },
        {
          "description": "can count one nucleotide in multi-character input.",
          "property": "nucleotideCounts",
          "strand": "GGGGGGG",
          "expected": {
            "A": 0,
            "C": 0,
            "G": 7,
            "T": 0
          }
        },
        {
          "description": "can count all nucleotides in a strand containing all nucleotides.",
          "property": "nucleotideCounts",
          "strand": "AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC",
          "expected": {
            "A": 20,
            "C": 12,
            "G": 17,
            "T": 21
          }
        },
        {
          "description": "ignores case in a strand of mixed-case nucleotides.",
          "property": "nucleotideCounts",
          "strand": "aGcTtTtCaTtCtGaCtGcAaCgGgCaAtAtGtCtCtGtGtGgAtTaAaAaAaGaGtGtCtGaTaGcAgC",
          "expected": {
            "A": 20,
            "C": 12,
            "G": 17,
            "T": 21
          }
        },
        {
          "description": "handles incorrect inputs.",
          "cases": [
            {
              "description": "treats an input with anything else than ACGT-characters as error.",
              "property": "nucleotideCounts",
              "strand": "AGUU1+ :'A'}CT",
              "expected": {
                "error": "Invalid nucleotide in strand"
              }
            }
          ]
        }
      ]
    }
  ]
}