Error executing process > 'MIRA_NF:MIRA:sc2_wgs_o:PREPONTREADS:TRIMLEFT

[JiazhangCai]

Description of feature

Hi,

I have been getting the following error with the pipeline and wondering if you can help me figure out a solution

executor >  slurm (6)
[3d/08cb7e] MIR…c2_wgs_o:CONCATFASTQS (s1) | 1 of 1 ✔
[f1/84bff9] MIR…o:NEXTFLOWSAMPLESHEETO (1) | 1 of 1 ✔
[f9/c2aee3] MIR…HECK:SAMPLESHEET_CHECK (1) | 1 of 1 ✔
[16/b24a02] MIR…TREADS:FINDCHEMISTRYO (s1) | 1 of 1 ✔
[17/296752] MIR…PREPONTREADS:TRIMLEFT (s1) | 0 of 1
[-        ] MIR…s_o:PREPONTREADS:TRIMRIGHT -
[-        ] MIR…_o:PREPONTREADS:CUTADAPT30 -
[-        ] MIRA_NF:MIRA:sc2_wgs_o:IRMA    -
[-        ] MIR…HECKIRMA:CONFIRMIRMAOUTPUT -
[-        ] MIR…wgs_o:CHECKIRMA:PASSFAILED -
[-        ] MIR…:CHECKIRMA:CREATEDAISINPUT -
[-        ] MIR…IRA:sc2_wgs_o:DAISRIBOSOME -
[f1/b65e97] MIR…PORTS:CHECKMIRAVERSION (1) | 1 of 1 ✔
[-        ] MIR…AREREPORTS:PREPAREIRMAJSON -
[-        ] MIR…:PREPAREREPORTS:STATICHTML -
Pulling Singularity image docker://cdcgov/mira-nf:bbtools-alpine [cache /home/jc27544/singularityIMG/cdcgov-mira-nf-bbtools-alpine.img]
ERROR ~ Error executing process > 'MIRA_NF:MIRA:sc2_wgs_o:PREPONTREADS:TRIMLEFT (s1)'

Caused by:
  Process `MIRA_NF:MIRA:sc2_wgs_o:PREPONTREADS:TRIMLEFT (s1)` terminated with an error exit status (1)


Command executed:

  bbduk.sh \
      in=s1.fastq.gz \
      out=s1_bartrim_l.fastq \
      hdist=3 \
      literal=AAGAAAGTTGTCGGTGTCTTTGTG \
      ktrim=l \
      k=17 \
      qin=33 \
      rcomp=f \
      1> s1.barcode01.trim_left.stdout.log \
      2> s1.barcode01.trim_left.stderr.log
  
  cat <<-END_VERSIONS > versions.yml
  "MIRA_NF:MIRA:sc2_wgs_o:PREPONTREADS:TRIMLEFT":
      trimleft_bbduk: $(bbversion.sh |& sed '1!d ; s/bbtools //')
  END_VERSIONS

Command exit status:
  1

My command line is:

nextflow run $mira_path/main.nf \
    -profile singularity,slurm \
    --input $run_path/samplesheet.csv \
    --outdir $out_dir \
    --runpath $run_path \
    --e SC2-Whole-Genome-ONT

[kristinelacek]

Hi there! Thanks for opening an issue!

Is this your first time running MIRA-NF?

Can you verify this singularity image was successfully pulled?

What is in /home/jc27544/singularityIMG/ ?

Sometimes, a user's singularity profile is not properly configured on HPC, and you may have to run the Singularity pulls independent prior to running MIRA (only once though) ex: singularity pull docker://cdcgov/mira-nf:bbtools-alpine

[JiazhangCai]

Hi there! Thanks for opening an issue!

Is this your first time running MIRA-NF?

Can you verify this singularity image was successfully pulled?

What is in /home/jc27544/singularityIMG/ ?

Sometimes, a user's singularity profile is not properly configured on HPC, and you may have to run the Singularity pulls independent prior to running MIRA (only once though) ex: singularity pull docker://cdcgov/mira-nf:bbtools-alpine

Thank you for getting back to me so quickly. Yes, it is my first time running MIRA-NF on our cluster. Since our cluster does not support docker, I have to use the singularity. There are two files in the /home/jc27544/singularityIMG/ cdcgov-mira-nf-bbtools-alpine.img and cdcgov-mira-nf-python3.10-alpine.img. What should I do with them?

By the way, I used the sbatch file to submit the job. Before I encountered this error, I made some modifications to the .config file.

Thanks!